GENE polarity 5’                                                    3’
Βactin sense ATCTGGCACCACACCTTCTAC
  antisense GAAGGTCTCAAACATGATCTGG
PRDX6 sense ATCATCGATGATAGGAATC
  antisense CTTCAGCTTCTTATCAGGA
EMR sense AAGTATTCCAACTGCTCT
  antisense ATTGGCCCTCCTCCACTA
ITGAM sense TCCAGAGGCTGTGAATAT
  antisense CTTCTGAAAGTCAATGTTGT
COL1A2 sense CGTTCCCAAAGATGGTAGAT
  antisense AGCCACCTCCGCTGACACCA
IL-4 sense ATGTGCCAAACGTCCTCACA
  antisense AGAACACTAGAGTTCTTCTT
IL-7 sense AAATGACAGGAACTGATAGT
  antisense GACATTGAATTCTTCACTGA
IL-10 sense TACAGCCGGGAAGACAATAA
  antisense AAGGAGTCGGTTAGCAGTAT
IL-12 sense AGAATCACAACCATCAGCAG
  antisense TTCACTCTGTAAGGGTCTGC
Table 1: Primer sequences. Shown are the indicated primer sets used to analyze gene expression by QRT-PCR.