Gene Sequence Size (bp) Accession number
CXCL1 probe CCTCGCGACCATTCTTGAGTGTGGCTATGAC 142 NM_008176.2
CXCL1 for CAGACCATGGCTGGGATTC    
CXCL1 rev GAACCAAGGGAGCTTCAG    
CXCL2 probe CCCTGCCAAGGGTTGACTTCAAGAACATCC 155 X53798
CXCL2 for AGTGAACTGCGCTGTCAATG    
CXCL2 rev GCTTCAGGGTCAAGGCAAAC    
MLN 51 probe CACGGGAATCTCGAGGTGTGCCTAAC 134 NM_138660.2
MLN 51 for CCAAGCCAGCCTTCATTCTTG    
MLN 51 rev TAACGCTTAGCTCGACCACTCTG    
Information obtained from the National Resource for Molecular Biology Information (www.ncbi.nlm.nih.gov). Abbreviations: for, forward; rev, reverse
Table 1: Primer sequences, amplicon sizes, and gene accession numbers of the analyzed genes.