Probe Taxa Sequence (5’-3’)  Hybridizing Temp (°C)   Refernce
EUB338 Domain Bacteria                                GCTGCCTCCCGTAGGAGT 48 Amann et al. [46]
ALF1b α-proteobacteria                   CGTTCG (C/T)TCTGAGCCAG 54 Amann et al. [47]
GAM42a γ-proteobacteria GCCTTCCCACATCGTTT 57 Manz et al. [48]
SRB385 Sulfate-Reducing-Bacteria CGGCGTCGCTGCGTCAGG 53 Amann et al. [46]
β -AO233 Ammonia-oxidizing-Bacteria AGCTAATCAGRCATCGG 44  
M-450 Type I Methanotrophs ATCCAGGTACCGTCATTATC 46 Eller et al. [4]
M-84 Type II Methanotrophs CCACTCGTCAGCGCCCGA 46  Eller et al. [4]
Table 1: Oligonucleotide sequences, target and hybridization conditions for probes used in this study