Primer name Restriction Enzyme sites Sequence
celBF XhoI 5´GCGCTCGAGATGCTTACAGTGAATAAGAAG3´
celBR SmaI 5´GCGCCCGGGTTATTTTACGTCTACGCTCC3´
celCF EcoRI 5´GCGGAATTCATGCCACGCGTGCTGCACTAC3´
celCR Bgl II 5´GCGAGATCTTTACGGTGTTGTTATGCATTGGC3´
pehF EcoRI 5´GCGGAATTCATGGAATATCAATCAGGCAAG3´
pehR Bgl II 5´GCGAGATCTTTATTTCTTAACGTTGACGTTCTTG3´
Table 1: The designed oligonucleotide primers and their corresponding restriction enzyme sites.