Primer

Target DNA

Sequence (5’- 3’)

Reference

MMV6

Methylobacterium mesophilicum 16SrDNA

ACGTGGAGAGATTCACGG

Rossetto et al., 2000

CF16S

Curtobacterium flaccumfaciens 16SrDNA

ATCAGGAGCTTGCTCCTGTGA

Rossetto et al., 2000

530R

16S rDNA

CCGCGGCKGCTGGCAC

Lane, 1985

R1378

Bacterial 16S rDNA

CGGTGTGTACAAGGCCCGGGAACG

Heuer et al., 1997

U968-GC

Bacterial 16S rDNA

CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG-AACGCGAAGAACCTTAC

Heuer et al., 1997

PO27F

Bacterial 16S rDNA

GAGAGTTTGATCCTGGCTCAG

Lane, 1985

Table 1: Primers used in this study, target organism and sequence.