Gene ID

Primer sequence (5´- 3´)

Expected size (bp)

Annealing Temperature

PR1
At2g14610

Forward: TCTCCGCCGTGAACATGTGGGTTAGCG
Reverse: GTATGGCTTCTCGTTCACATAATTCCC

200

67°C

MPK1
At1g10210

Forward: GATCCGTCAAAGAGGATTAGTGTCTCTG
Reverse: TCAGAGCTCAGTGTTTAAGGTTGAAGC

200

58°C

TGA1
At5g65210

Forward: GGTGAATTCTGCTATGGATGAATTAGAAGC
Reverse: CTACGTTGGTTCACGATGTCGAGTTGC

200

65°C

18S rRNA
At1g49240

Forward: GCCCCGGGTAATCTTTGAAATTTCAT
Reverse: GTGTGTACAAAGGGCAGGGACGTA

150

63°C

TuMV-GFP

Forward: CATGGCAAGTAAAGGAGAAGAACTTTT
Reverse: CTTCATATGATCTGGGTATCTTG

250

54°C

TuMV-CP

Forward: GGACGGCGACGATCAGGTGGAAATTCCCG
Reverse: CAACCCCTGAACGCCCAGTAAG

400

63°C

Table 1: Oligonucleotide Primers used in this study.