Name Sequence (5’ à 3’)a Applications Cut1F CTTGTCGCTGCCGCTCCTGT Reverse transcription PCR Cut1R AGAGTCGCTTAGCCTCGTTGAT Reverse transcription PCR gCUT-F AATCCCTTACAACTTTCCTCTGACA Cutinase gene amplification gCUT-R ATCAACCGCCACGATACAGACAA Cutinase gene amplification SmaI-CutS-F TATATAcccgggTCATCTCTCTTGCCGTTTC Cassette construction, Southern analysis XbaI-CutS-R TCAGATtctagaGTCCAAGGTTCTGCAGGTTC Cassette construction, Southern analysis BamHI-CutAS-F TAGTATggatccGTCCAAGGTTCTGCAGGTTC Cassette construction XhoI-CutAS-R ATTCGActcgagTCATCTCTCTTGCCGTTTC Cassette construction S-GFP-R TCGCCGATGGGGGTGTTCTGCT PCR, Southern analysis 5NQ.CUTF TCTGTTCGGCTACACCAAGAA Quantitative real-time PCR 5NQ.CUTR CAAGAAATGCGCCGGCAGGAT Quantitative real-time PCR hphF GCTGCGCCGATGGTTTCTACA pAA1 analysis hphR GCGCGTCTGCTGCTCCAT pAA1 analysis aRestriction sites are bolded lower case letters

Table 1: List of primers used in the study.