Gene Symbol RefSeq Accession Forward Primer (5'-3') Reverse Primer (5'-3') Product Size (bp) Annealing Temperature (°C)
Actb* NM_007393.3 CCAGATCATGTTTGAGACCTTCAA CCAGAGGCATACAGGGACAGC 78 59
Dab2 NM_001008702.2 TCATTCTCCCTATGGCTTGG GCTGAGCAGAATCCAGTTCC 83 60
Ddx3y NM_012008.2 GGGTCTGTGATAAGGACAGTTCA CACGACCACCAATACCATCATAG 177 60
Dhcr24 NM_053272.2 CTCTGGGTGCGAGTGAAGG TTCCCGGACCTGTTTCTGGAT 195 60
Eif2s3x NM_012010.3 GGTGAGGGTGGAGTGACTCT TTCCCATGAGCTACGTGACCA 152 60
Eif2s3y NM_012011.1 GGTGCTGTTGGAGCATTACC TCAACTCGTCGGCTTAGAGC 269 58
Kdm5d NM_011419.3 CCAGGATCTGACGACTTTCTACC TTCTCCGCAATGGGTCTGATT 113 58
Kdm6a NM_009483.1 CGGGCGGACAAAAGAAGAAC CATAGACTTGCATCAGATCCTCC 203 60
Klk8 NM_008940.2 GATCCTGGAAGGTCGAGAGTG CTGCTCCGGCTGATCTCTG 193 58
Mid1 NM_183151.1 CTGTGACGGCACCTGTCTC AAACGGCTGACTGTTGGTCTT 205 58
Prkdc NM_011159.2 CTGTGACGGCACCTGTCTC TCTCAATCTGAGGACGAATTGC 203 58
Rpl13a* NM_009438.5 ATGAGGTCGGGTGGAAGTACC CAGGAGTCCGTTGGTCTTGAG 179 62
Xist NR_001570.2 GCTGGTTCGTCTATCTTGTGGG GGATCCTGCACTGGATGAGT 225 58
Table 1: List of the PCR primer sequences. *indicates a reference/housekeeping gene.