RUNX2

Forward

CGAAATGCCTCCGCTGTTAT

Reverse

CGCTCCGGCCCACAA

OPN

Forward

CATGAAGAGCGGTGAGTCTAAGG

Reverse

CTTTCCGTTGTTGTCCTGATCA

BSP

Forward

AGGACTGCCGAAAGGAAGGT

Reverse

ATGGAGACGGCGATAGTTCC

OCN

Forward

TGCTTGTGACGAGCTATCAG

Reverse

GAGGACAGGGAGGATCAAGT

GAPDH

Forward

AACGACCCCTTCATTGAC

Reverse

TCCACGACATACTCAGCAC

Table 1: Primer sequences for QRT-PCR.