Gene(a)

Primers

Thermal conditions

(No. of cycles)

Sequence

Concentration (pmoles/50µl) of PCR mix

GH

GH1F: CTCTGCCTGCCCTGGACT
GH1R:GGAGGAGCAGAAGGCAACC
GH2F:(TCAGCAGAGTCTTCACCAAC
GH2R:(CAACAACGCCATCCTCAC

20

94°C/15 min, 95°C/30 s, 59°C/30 s, 72°C/45 s, 72°C/7 min

35

CSN1S1

Casein
S1F: 5’TTCTAAAAGTCTCAGAGGCAG3’
S1R 5’GGGTTGATAGCCTTGTATGT3’

50

97°C/2 min, 60°C/45 s, 72°C/2.5 min, 94°C/45 s, 60°C/45 s,72°C/2.5 min, 72°C/10 min

30

MHC Class II DRB

DRB 1: TATCCCGTCTCTGCAGCACATTTC
DRB2: TCGCCGCTGCACACTGAAACTCTC

20

94°C/1 min, 60°C/1.5 min, 72°C/2 min

30

PrP

PrP G1: 5’ATGGTGAAAAGCCACATAGGCAGT3)
PrP G2: 5’CTATCCTACTATGAGAAAAATGAG3’

20

95°C/5 min, 96°C/2 min, 60°C/2 min, 72°C/3 min, 72°C/7 min

40

(a)DNA level used in all protocols was constant (93.0 ng/50μl reaction mix)
Table 1: Optimized protocol for amplification of multiple genes in DNA of a reference Saanen goat sperms.