DNA cloned region Primers Anneling Temperature (°C) Fragment (bp)
PCR 1 for CGI-1 1-F1I1 TTGATTTTAAGTTGGTTGTA 43, 45, 47 684
2-R1I1 CTTTACTACAACTCTCATTCTA
PCR2 for CGI-1 3-FNI1 TTTGTTTGTTTATTTTTTATTTATTGT 47, 49, 51 454
4-RNI1 ATCCCTAAACCTCTCTCAAATAAAC
PCR1 for CGI-2F 5-FFI2 GGGAAGAGTTTTTTGGATTTAGAAG 41, 43, 45 696
6-RFI2 TTATTATCCCTATAACAAAACC
PCR2 for CGI-2F 7-FNFI2 FNGAGTTTTTAGTTTTTTGGGT 44, 46, 48,5 511
8-RNFI2 CAATAAAAAACAAACAAATTAATC
PCR1 for CGI-2I 9-FII2 GGATTAATTTGTTTGTTTTTTATTG 52, 54, 56 711
10-RII2 AACTACCTCCACCCCCACTATAT
PCR2 for CGI-2I 11-FNII2 GGGGTTTTGTTATAGGGATAATAA 54, 56, 58 595
PCR1 for CGI-3 12-FI3 GGATTTTTTAGGGATAGGGA 44, 46, 48 453
13-RI3 TCTAACAAACAAACAATACTCA
PCR2 for CGI-3 14-FNI3 GTTGGGAAGGATATAGAGAGGTGGTT 46, 48, 50 271
15-RNI3 AAACTAAAAACTCCCCCACCCC
PCR1 for CGI-5 16-FI5 AATGGTTTGGTTTGATGGT 46, 48, 50 668
17-RI5 ACACCCACTATATACTAAACCT
PCR2 for CGI-5 18-FNI5 ATTTAGGTTGGAGTGTAG 46, 48, 50 306
19-RNI5 ACAAACCTCACAATTTTA
Table 1: Summary of primer sequences, used for nested-PCR cloning.