S.NO

Genes

F-Primer 5 '→ 3'

R-Primer 5' → 3'

Annealing Temp size

1

BRCA1 TGCTTGAAGTCTCCCTTG CTTCCATTGAAGGGTCTG 58 267bp

2

BRCA2 ACCCTTTCAGGTCTAAATGG TGCCTGCTTTACTGCAAG 58 268bp

3

PR CGCGCTCTACCCTGCACTC TGAATCCGGCCTCAGGTAGTT 60 121bp

4

ESR CTTGTGCAGGATTGTTGTG GCCAATTGTAGGAACACAG 61 269bp

5

EGFR TTAGCAGGAAAGGCACTG CAGCTTCATCCTACACAAG 58 269bp

6

Her-2neu AGTACCTGGGTCTGGACGTG CTGGGAACTCAAGCAGGAAG 51 194bp

7

MET GAAGACCTTCAGAAGGTTG TGGGGAGAATATGCAGTG 54 267bp

8

PI3KCA GGACAATCGCCAATTCAG TGGTGGTGCTTTGATCTG 57 268bp

9

PTEN GACAGACTGATGTGTATACG GTGTAAATAGCTGGAGATGG 58 269bp

10

BRAF ATGGTGATGTGGCAGTGAAA TAGCCAGTTGTGGCTTTGTG 58 150bp

11

K-RAS AGGGCAGTTTGGATAGCTCA CACCACCCCAAAATCTCAAC 51 153bp

12

GAPDH AATCCCATCACCATCTTCCAG AAATGAGCCCCAGCCTTC 54-60 121bp
Table 1: Details of qRT-PCR primers, along with the target band size and annealing temperatures.