Table A Hematologic responses
Complete or major hematological response Partial or minor hematological response Loos or minimal hematological response
Platelet count >150x 109/L WBC count < 10 x 109/L Basophils :< 5% Differential without immature granulocytes. Absence of blasts and promyelocytes in peripheral blood Spleen : nonpalpable spleen Platelet count <450 x 109/L WBC count >10 x 109/L Basophils :>10% Presence of blasts and promyelocytes in peripheral blood Spleen : Palpable spleen Platelet count < 450 x 109/L WBC count >20 x 109/L Basophils :15% Presence of blasts and promyelocytes in peripheral blood Spleen : Palpable spleen
Table B Molecular response
Major molecular response Minimal or No Molecular response
It indicates nonquantifiable and nondetectable bcr-abl gene transcript (BCR-ABL/ABL) 0.103 3 log reduction of BCR-ABL/ABL It indicates quantifiable and detectable bcr-abl gene transcript (BCR-ABL/ABL) ≥0.103 No 3 log reduction of BCR-ABL/ABL
C5e 5’ATAGGATCCTTTGCAACCGGGTCTGAA3’
B2B 5’ACAGAATTCCGCTGACCATCAATAAG3’
BCR-C 5’ ACCGCATGTTCCGGGACAAAAG3’
CA3 5’TGTTGACTGGCGTGATGTAGTTGCTTGG3’
Transcript primers used Size (bp)
Control BCR B2B and C5e 808bp
b2a2 B2B and CA3 310bp
b3a2 B2B and CA3 385bp
e1a2 BCR-C and CA3 481bp
Table 1: Sequence of oligonucleotides used in multiplex RT-PCR for detection of BCR-ABLtranscript as the target gene and BCR transcripts as the internal control.