Forward primer 5´>3´ Reverse primer 5´>3´  
GSTP1 M TTCGGGGTGTAGCGGCGTC GCCCCAATACTAAATCACGACG 57°
U GATGTTTGGGGTGTAGTGGTTGTT CCACCCCAATACTAAATCACAACA
P16 M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA 60°
U TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA
CyclinD2 M GGCGGATTTTATCGTAGTCG CTCCACGCTCGATCCTTCG 57°
U AGAGTATGTGTTAGGGTTGATT ACATCCTCACCAACCCTCCA
RAR 2 M GAACGCGAGCGATTCGAGT GACCAATCCAACCGAAACG 55°
U GGATTGGGATGTTGAGAATGT CAACCAATCCAACCAAAACAA
RASSF1A M GTTGGTATTCGTTGGGCGC GCACCACGTATACGTAACG 57°
U GGTTGTATTTGGTTGGAGTG CTACAAACCTTTACACACAACA
HIN-1 M GGTACGGGTTTTTTACGGTTCGTC AACTTCTTATACCCGATCCTCG 57°
U GGTATGGGTTTTTTATGGTTTGTT CAAAACTTCTTATACCCAATCCTCA
SOCS1 M1 GTT GTA GGA TGG GGT CGC GGT CGC CTA CTA ACC AAA CTA AAA TCC ACA 63°
U1 GTT GTA GGA TGG GGT TGT GGT TGT CTA CTA ACC AAA CTA AAA TCC ACA
M2 TTGTTCGGAGGTGGATTT ACTAAAACGCTACGAAACCG
U2 TTTTTTCCTCTTCGTTTGGAGGTTGGATTTT AAAACAAAACAATAAACTAAAACACTACAAAACCA
TWIST M TTT CGG ATG GGG TTG TTA TC AAA CGA CCT AAC CCG AAC G 56°
U TTT GGA TGG GGT TGT TAT TGT CCT AAC CCA AAC AAC CAA CC
TIMP3 M CGTTTCGTTATTTTTTGTTTTCGGTTTC CCGAAAACCCCGCCTCG 59°
U TTTTGTTTTGTTATTTTTTGTTTTTGGTTTT CCCCCAAAAACCCCACCTCA
DAPK M GGA TAG TCG GAT CGA GTT AAC GTC CCC TCC CAA ACG CCG A 57°
U GGA GGA TAG TTG GAT TGA GTT AAT GTT CAA ATC CCT CCC AAA CAC CAA
Table 2: MSP-primers sequences for selected genes. M: Methylated; U: Unmethylated. Melting temperature are shown.