alexa Characterization of Polymorphic Microsatellite Markers Isolated from Genomic DNA of Elaeocarpus decipiens Hemsly (Elaeocarpaceae) | Open Access Journals
ISSN: 2153-0602
Journal of Data Mining in Genomics & Proteomics
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Characterization of Polymorphic Microsatellite Markers Isolated from Genomic DNA of Elaeocarpus decipiens Hemsly (Elaeocarpaceae)

Xi Gong1* and Gang Ge2

1College of Life Sciences and Food Engineering, Nanchang University, Nanchang 330047, China

2Key Laboratory of Plant Resources, Jiangxi Province, College of Life Sciences and Food Engineering, Nanchang University, Nanchang 330031, China

*Corresponding Author:
Xi Gong
College of Life Sciences and Food Engineering
Nanchang University, Nanchang 330047, China
E-mail: [email protected]

Received Date: September 11, 2013; Accepted Date: October 07, 2013; Published Date: October 10, 2013

Citation: Gong X, Ge G (2013) Characterization of Polymorphic Microsatellite Markers Isolated from Genomic DNA of Elaeocarpus decipiens Hemsly (Elaeocarpaceae). J Data Mining Genomics Proteomics 4: 141. doi: 10.4172/2153-0602.1000141

Copyright: © 2013 Gong X, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Data Mining in Genomics & Proteomics

Abstract

The development of compound microsatellite markers was conducted in Elaeocarpus decipiens to investigate genetic diversity and population genetic structure of this species. Eighteen microsatellite markers that were successfully amplified showed polymorphism when tested on 35 individuals from three populations in Chinese mainland. Overall, the number of alleles per locus ranged from 4 to 11, with an average of 7.06 alleles per locus. These results indicate that these microsatellite markers are adequate for detecting and characterizing population genetic structure and genetic diversity in E. decipiens. Of these primers, only four could be successfully transferred to E. sylvestris and E. japonicus.

Keywords

Elaeocarpus decipiens; Microsatellite markers; Genomic DNA; Genetic diversity

Introduction

Elaeocarpus decipiens is an evergreen, broad-leaved, woody species of the Elaeocarpaceae family with a disjunct distribution in south of Chinese mainland, the Ryukyu Archipelago and Taiwan. Currently, most of the efforts have been focused on the germplasm, breeding and cultivation of this species [1]. The study of population genetic diversity, population genetic structure and population ecology of this species is insufficient and limited. However, population genetic analysis of this disjunct plant will potentially provide insights into the geographic structure of genetic diversity that reflects the evolutionary history of E. decipiens. To assess gene flow across the populations and to infer biogeographic patterns, we developed microsatellite markers for this species, for which none were available previously. Additionally, these loci were tested for cross-amplification in E. sylvestris and E. japonicas.

Materials and Methods

Genomic DNA of E. decipiens was extracted from fresh leaves using a modified CTAB (cetyltrimethyl ammonium bromide) method [2]. An adaptor-ligated DNA library was constructed following the protocol of Lian et al. [3]. Briefly, total genomic DNA (10 μg) was digested with a blunt-end restriction enzyme, EcoRV (Takara, Dalian, Liaoning, China), and the restricted fragments were ligated to an unequal-length adaptor, using DNA Ligation Kit Version 2.0 (Takara, Dalian, Liaoning, China). Then, fragments flanked by a microsatellite at one end were amplified from the EcoRV DNA library using compound SSR primer (AC)6(AG)5 and an adaptor primer AP2 (5′-CTATAGGGCACGCGTGGT-3′). The recovered DNA was ligated into a pGEM-T vector (Promega, Madison, Wisconsin, USA), and transformed into DH5α competent cells (Takara, Dalian, Liaoning, China). Transformants were cultured on selective agar media with ampicillin, X-Gal and IPTG, for blue/white colony selection. After PCR-tested for insert size of the white colonies, a total of 144 clones were found to contain (AC)6(AG)n compound SSR motifs. 55 sequences were too short to design primer. And 89 clones proved suitable for primer design using PREMIER version 5.0 [4]. These primers were tested for polymorphism in E. decipiens. A total of 53 out of the 89 primer pairs tested successfully amplified the target fragments. PCR was performed in 10-μL reaction volumes containing 30-50 ng/ μL of template DNA, 0.25 unit Taq DNA polymerase (TaKaRa, Dalian, Liaoning, China), 1 μL 10×PCR buffer, 0.5 μL of 2.5 mM MgCl2,1 μL of 2.5 mM dNTPs, 0.05 μL bovine serum albumin (BSA) (TaKaRa, Dalian, Liaoning, China), and 0.6 μL of each 10 μM primer. The thermal profile used was initial denaturing for 5 min at 95°C, followed by 30 cycles of 30 s at 95°C, 45 s of annealing at the optimized annealing temperature (Table 1), 1 min 30 s of elongation at 72°C, ending with a 10-min extension at 72°C. The forward primer of each pair was labeled with a fluorescent dye (6-FAM). Products were resolved using an ABI 3730 sequencer (Applied Biosystems), along with a fluorescently labeled internal size standard (GeneScan 500 LIZ Size Standard; Applied Biosystems), and the samples were genotyped using GENEMAPPER version 4.0 (Applied Biosystems).

Locus Repeat Primer sequence (5’–3’) s Ta ( C°) A GenBank Cross-amplification
Ed1 (AC)6(AG)17 F: ACACACACACACAGAGAGAGAG
R: CTGATGTTGCCACGGAGT
277
265-303
54 10 JX193598  
Ed2 (AC)6(AG)7 F: ACACACACACACAGAGAGAGAG
R: TCAAAACACAAAAAAACTCA
171
167-194
52 9 JX193599  
Ed3 (AC)6(AG)6 F: ACACACACACACAGAGAGAGAG
R: ATACAAATTGAACAAGGGCTTA
314
312-330
53 8 JX193600  
Ed4 (AC)6(AG)6 F: ACACACACACACAGAGAGAGAG
R: AGTTTGAGGCTTTATTCAGTTT
213
211-225
54 5 JX193601  
Ed5 (AC)6(AG)7 F: ACACACACACACAGAGAGAGAG
R: ACAGGGTTCTTGCTATTTCA
187
185-218
53 7 JX193602  
Ed6 (AC)6(AG)9 F: ACACACACACACAGAGAGAGAG
R: GCCACCAATCCTTGAACCT
175
169-212
54 9 JX193603 a, b
Ed7 (AC)6(AG)7 F: ACACACACACACAGAGAGAGAG
R: TGTCATTGATGGGAAAAACT
291
289-334
53 10 JX193604  
Ed8 (AC)6(AG)11 F: ACACACACACACAGAGAGAGAG
R: AAATGTCATAATCAAAAAGCAG
134
124-154
51 9 JX193605  
Ed9 (AC)6(AG)6 F: ACACACACACACAGAGAGAGAG
R: TGATTCTTGATGTCCTTCTATT
179
177-199
54 5 JX193606 a
Ed10 (AC)6(AG)9 F: ACACACACACACAGAGAGAGAG
R: GCTTTTGAGGGCTATTGATG
216
208-232
54 8 JX193607  
Ed11 (AC)6(AG)11 F: ACACACACACACAGAGAGAGAG
R: CATCACCTTTTTCCCTATCA
402
394-418
53 5 JX193608 a, b
Ed12 (AC)6(AG)6 F: ACACACACACACAGAGAGAGAG
R: TCGGGAATGAAAAAAAATAG
159
157-204
53 5 JX193609 a, b
Ed13 (AC)6(AG)6
CG(AG)5
F: ACACACACACACAGAGAGAGAG
R: GGGAGATAGAGATAGAGACG
184
174-199
55 4 JX193610  
Ed14 (AC)6(AG)6 F: ACACACACACACAGAGAGAGAG
R: ATTTCATTTGGTGGGCTTT
284
284-308
55 4 JX193611  
Ed15 (AC)6(AG)8 F: ACACACACACACAGAGAGAGAG
R: ATCCTTTTTAGATTTCGTTTTA
195
190-223
54 5 JX193612  
Ed16 (AC)6(AG)11 F: ACACACACACACAGAGAGAGAG
R:TACCACATAAACAAACCATT
386
376-411
54 9 JX193613  
Ed17 (AC)6(AG)12 F: ACACACACACACAGAGAGAGAG
R:TTATCAAAAAATCAACAAAT
291
280-322
53 11 JX193614  
Ed18 (AC)6(AG)6
AC(AG)3
F: ACACACACACACAGAGAGAGAG
R:CGGTTATGCCACGGACTT
277
271-298
56 4 JX193615  

Table 1: Characteristics of 18 compound microsatellite loci developed for E. decipiens. Shown for each locus are the locus name, the forward (F) and reverse (R) primer sequence, the optimized annealing temperature (Ta), allele size ranges, the total number of alleles per locus (A) and the GenBank accession number. Size ranges and the total number of alleles include all values detected within three E. decipiens populations used in this study (Table 2).

Polymorphisms of these primers were assessed in 35 natural individuals of E. decipiens collected from Jinggang Mountain (JG, 26°35’19” N, 114°07’39” E), Laohunao Mountain (LHN, 27°13’18” N, 116°00’43” E) and Tongbo Mountain (TB, 28°04’57” N, 118°14’18” E). Voucher specimens for the sampled populations are stored at the Herbarium of Nanchang University (JXU). Parameters of genetic diversity including the expected heterozygosity (He) and observed heterozygosity (Ho), number of alleles (A) per locus, tests for linkage disequilibrium (LD), and deviation from Hardy–Weinberg equilibrium (HWE) were calculated using GENEPOP version 4.0.7 [5]. In addition, CERVUS version 3.0.3 [6] was employed to calculate the value of polymorphic information content (PIC).

Results

Eighteen out of the 53 loci were identified as polymorphisms and generated consistent amplification products of the expected size range (Table 1). These loci contained 4 to 11 alleles in the 35 individuals, with He and Ho ranging from 0.685 to 0.909 and from 0.583 to 0.917, respectively. On average, the PIC were 0.747 (range: 0.627-0.854), 0.756 (range: 0.654-0.845) and 0.751 (range: 0.605-0.850) for populations in JG, LHN and TB Mountains, respectively (Table 2). Six loci (Ed1, Ed2, Ed6, Ed7, Ed10 and Ed17) significantly deviated from HWE (P<0.05) due to heterozygote deficiency. In addition, significant linkage disequilibrium (LD) was not detected between any pair of loci. Microsatellite loci were all identified and their respective sequences were deposited in GenBank (Accession Nos. JX193598–JX193615). Details about the 18 microsatellite loci and their variability across the 35 individuals were summarized in Table 1. Additionally, crossamplification of the 18 prime pairs was performed in 2 individuals of E. sylvestris and E. japonicus. Of these primers, only four (Ed6, Ed9, Ed11 and Ed12) could be successfully transferred to the tested species (Table 1).

Locus Population JG (11) Population LHN(12) Population TB(12)
A Ho He PIC A Ho He PIC A Ho He PIC
Ed1** 9 0.818 0.905 0.849 8 0.583 0.848 0.789 8 0.750 0.859 0.800
Ed2 * 6 0.727 0.823 0.753 8 0.833 0.899 0.845 8 0.750 0.884 0.828
Ed3 n.s 5 0.818 0.797 0.720 6 0.917 0.855 0.794 7 0.667 0.837 0.777
Ed4 n.s 5 0.909 0.801 0.726 5 0.750 0.815 0.745 5 0.750 0.797 0.723
Ed5 n.s 7 0.727 0.874 0.813 5 0.833 0.815 0.746 6 0.750 0.797 0.731
Ed6* 7 0.818 0.831 0.765 7 0.750 0.804 0.738 8 0.750 0.855 0.797
Ed7* 7 0.818 0.866 0.803 7 0.833 0.884 0.828 7 0.667 0.833 0.770
Ed8 n.s 7 0.818 0.857 0.794 7 0.750 0.870 0.811 7 0.750 0.804 0.740
Ed9 n.s 5 0.818 0.827 0.756 5 0.750 0.812 0.741 5 0.750 0.819 0.750
Ed10** 7 0.818 0.840 0.773 6 0.667 0.841 0.778 7 0.583 0.866 0.808
Ed11 n.s 5 0.818 0.779 0.700 5 0.667 0.815 0.745 5 0.750 0.786 0.716
Ed12 n.s 5 0.818 0.766 0.687 5 0.583 0.808 0.737 5 0.750 0.830 0.762
Ed13 n.s 4 0.818 0.723 0.627 4 0.750 0.736 0.654 4 0.833 0.685 0.605
Ed14 n.s 4 0.818 0.775 0.691 4 0.750 0.764 0.683 4 0.833 0.764 0.683
Ed15 n.s 4 0.818 0.775 0.691 4 0.750 0.757 0.677 5 0.750 0.808 0.737
Ed16 n.s 9 0.818 0.853 0.791 6 0.750 0.851 0.790 6 0.750 0.819 0.753
Ed17** 10 0.818 0.909 0.854 7 0.833 0.884 0.828 9 0.667 0.902 0.850
Ed18 n.s 4 0.818 0.740 0.651 4 0.833 0.761 0.678 4 0.750 0.772 0.691

Table 2: Results of initial primer screening in three populations of E decipiens. Shown are locus name, the number of alleles per locus (A), mean values of observed (Ho) and expected (He) heterozygosity, and polymorphism information content (PIC). The sample size for each population is shown in parentheses.

Conclusion

The approach used in this study substantially reduces time in comparison with the FIASCO (Fast Isolation by APLR of Sequences Containing Repeats) protocol. Because a common fluorescent compound SSR primer can be used in polymorphism analyses for different loci and different species and the fluorescent primer is rather expensive, this may save investigation costs [7]. These polymorphic microsatellite markers of E. decipiens should represent a useful tool to assess patterns of geographical molecular variation in E. decipiens at the population level, and across the species’ ranges in south of Chinese mainland, Taiwan and the Ryukyu Archipelago. Moreover, studies have shown that microsatellite primers developed in one species could be cross-amplified in related taxa [8]. However, only three and four loci were successfully amplified in E. japonicus and E. sylvestris, respectively. Even so, cross-species amplification in E. sylvestris and E. japonicus has opened an opportunity for comparative studies among these species. In addition, the use of these markers will facilitate the follow up introgression of favorable variation from E. sylvestris and E. japonicus into E. decipiens.

Acknowledgement

This research was supported by the Science Foundation of Jiangxi Province (grant no. 20114BAB204012) and Education Department of Jiangxi Province (GJJ10085).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Article Usage

  • Total views: 11588
  • [From(publication date):
    October-2013 - Nov 24, 2017]
  • Breakdown by view type
  • HTML page views : 7804
  • PDF downloads : 3784
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords