alexa Design and Molecular Characterization of C-Kit Transgene Construct during Spermatogenesis in Mice | Open Access Journals
ISSN: 2157-7013
Journal of Cell Science & Therapy
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Design and Molecular Characterization of C-Kit Transgene Construct during Spermatogenesis in Mice

Swanand Koli1, Arun P Sikarwar2, Murali R Babu1 and Reddy KVR1*
1Division of Molecular Immunology & Microbiology (MIM), National Institute for Research in Reproductive Health (NIRRH), J.M.Street, Parel, Mumbai-400012, India
2Department of Biomedicine, Faculty of Health Sciences, Aarhus University, Denmark
Corresponding Author : Reddy KVR
Division of Molecular Immunology& Microbiology (MIM)
National Institute for Research in Reproductive Health (NIRRH)
J.M.Street, Parel, Mumbai-400012, India
Tel: +91-22-24192016
Fax: +91-22-24139412
E-mail: [email protected]
Received Febrauary 19, 2013; Accepted March 22, 2013; Published March 25, 2013
Citation: Koli S, Babu MR, Sikarwar AP, KVR (2013) Design and Molecular Characterization of C-Kit Transgene Construct during Spermatogenesis in Mice. J Cell Sci Ther 4:137. doi: 10.4172/2157-7013.1000137
Copyright: © 2013 Koli S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Cell Science & Therapy

Abstract

In the postnatal testis, undifferentiated Type-A Spermatogonial Stem Cells (SSCs) differentiate into Type-B Spermatogonial Cells (SGCs) in the presence of c-Kit, which is expressed in a cell/stage specific manner during spermatogenesis in mammals. c-Kit is subjected to tight transcriptional control as it is essential not only for germ cells but also for the development of hematopoietic stem cells and melanocytes. Although, c-Kit expression is a dynamically regulated process, the molecular basis for its transcriptional regulation during spermatogenesis remains mostly unidentified. The aim of the study is to determine whether or not introduction of c-Kit expressing transgene construct into c-Kit negative SSCs isolated from Wv/Wv mutant mice will differentiate and colonize in the testis of recipient mice. For this purpose, a 7.4 kb pG1-Kit-ORF-GFP transgene construct that contains a 4.4 kb c-Kit-ORFGFP expression cassette was designed and its in vitro expression was confirmed by immunofluorescence and flowcytometry analysis. For comparison of the results, three control-GFP constructs, having 1.1 kb (lacking both c-Kit promoter and ORF), 4.1kb (lacking c-Kit promoter) and 1.4 kb (lacking c-kit-ORF) were also designed and introduced into SSCs by electroporation (EP). These SSCs were introduced into the testis of busulfan treated recipient infertile mice via rete using Germ Cell Transplantation (GCT) approach. It was observed that SSCs carrying c-Kit-ORF-GFP transgene insert were able to colonized and differentiated into other germ cell lineages in the seminiferous tubules of recipient mice as compared to controls. In conclusion, the testis Wv/Wv mutant mice have the population of SSCs, wherein the function of c-Kit signaling is impaired for the first time we report that SSCs function in the recipient infertile mice could be resumed with the introduction of c-Kit-ORF-GFP transgene insert. Thus the present findings may have significant impact in understanding reproductive physiology and potential for novel future therapies in patients with testicular failure.

Keywords
c-Kit; Kit-GFP transgene construct; SSCs; Germ cell transplantation
Introduction
Spermatogenesis is highly complex, well-orchestrated and efficient biological process in which Spermatogonial Stem Cells (SSCs) undergo self-renewal, proliferation and differentiation to produce virtually unlimited number of spermatozoa [1]. During this process, several genes (c-myc, c-Kit, Oct-4, Androgen Binding Protein (ABP), Cyclic- AMP Responsive Modulator (CREM), Protamine-1, Heat Shock Protein-70 (HSP-70), Phosphogylcerate Kinase-2 (PGK-2), Transition Nuclear Protein-2 (TNP-2) and Azoospermic Factor-1 (AZF-1) etc.) are known to be expressed in cell and stage specific manner in the testis [1,2]. Among these genes, great attention has been focused in recent years on c-Kit, since it is indispensable right from the gonadal development to the differentiation of SSCs. Lack of or poor expression of c-Kit is responsible for abnormal spermatogenesis and infertility in males. In certain cases infertility has been attributed to functional defects in c-Kit [3,4]. c-Kit-SCF (Stem Cell Factor) signaling is essential for the survival of SSCs [3,4]. However, the molecular basis of male infertility arising from defects in c-Kit remains poorly understood.
c-Kit, a type III Receptor tyrosine kinase (RTK) that has sequence and structural similarities to the platelet-derived growth factor receptor-β-polypeptide (PDGFRB) family of RTKs [5,6]. c-Kit is allelic to the W locus on the mouse chromosome-5 [7,8]. The 21-exon c-Kit gene encodes 5.15 kb transcript, which translates into a product of ~150 kDa protein with 979 amino acids [8-10]. In the testis of mouse, development, proliferation and migration of primordial germ cells (PGC) starts at 7.5 day post coitum (dpc) and c-Kit mRNA expression is detected in the PGCs, From 15 dpc to 3 day post-partum (dpp), c-Kit expression is markedly reduced which coincides with the period of gonocytes quiescence [3,8]. Synthesis of c-Kit mRNA and protein during testicular development is in concordant with the first appearance of differentiating SSCs (A1-A4) which occur at 7 dpp.
Studies on the transcription factors that enhances or represses c-Kit promoter activity would determine the cellular expression during normal and abnormal spermatogenesis, which will provide valuable clues about the mechanisms underlying the development and differentiation of SSCs. After considering various transcription factors reported in the literature for optimal c-Kit activity, we designed germ cell specific c-Kit transgene construct. For instance, the transcription of the c-Kit is controlled by regulatory sequences located in the 5’ flanking region of the gene [10,11]. This region includes both core promoter sequences and also tissue-specific enhancer sequences. The Proximal Promoter Region (PPR) is located 58 bp upstream of translation start site in the mouse promoter region. The PPR contains consensus regulatory binding sites such as SP1, Ap-2 and short GA-rich elements [10-13].
SSCs are the only adult stem cell that contributes genes to subsequent generations. Recently studies revealed that SSCs have received a great deal of attention due to success in achieving their isolation and maintain them in cultures under undifferentiated condition. Brinster and group who are the pioneers in this area have reported in one of their papers that SSCs can be genetically modified and make them to differentiate into fully competent spermatozoa following transplantation into the recipient mice testis [14]. In the past, several investigators have demonstrated that busulfan treated mice can serve as a good recipient model in Germ Cell Transplantation (GCT) studies [14,15]. In one of these studies it has been demonstrated that, following testicular GCT of SSCs, isolated from Wv/Wv mutant mice were able to colonize the seminiferous tubules in the busulfan-treated mice [15]. However, these cells failed to differentiate due to defects in the KIT/KITL signaling system. In the present study, we used Wv/Wv mutant mice as a source for the isolation of undifferentiated SSCs. We designed 7.4 kb pG1-Kit- ORF-GFP transgene construct from which a 4.4 kb c-Kit-GFP insert was excised and introduced into SSCs by electroporation (EP). Upon transplantation of SSCs carrying c-Kit-ORF-GFP transgene insert into the seminiferous tubule of busulfan treated recipient mice testis, they were differentiated and subsequently colonized. To the best of our knowledge this is the first study revealing the design of testis specific c-Kit-ORF-GFP transgene construct and it’s in vitro expression and in vivo differentiation and colonization in the recipient mice testis.
Materials and Methods
Experimental animals
Male mice pups (n=36) were obtained by crossing C57BL/6 male mice with DBA/2 females. On 30 dpp, the male pups were administered with single injection of busulfan (40 mg/kg body weight) subcutaneously (s.c), to deplete the endogenous testicular germ cells. Post treatment day 30th, two mice were sacrificed by CO2 asphyxiation; testes were isolated and checked for the presence of c-Kit mRNA and protein expression. To determine whether the treatment has any adverse effect on Sertoli cells, expression of specific marker genes (GATA-1 and PEM-1) of these cells were determined. For the isolation of SSCs, Wv/Wv mutant mice were used (Jackson Laboratories, USA). All animals were housed at 25°C with 12L: 12D photoperiod and were given water and a standard diet ad libitum. The experimental protocols discussed in this study were approved by the Institutional Animal care and Ethics Committee (IAEC) of the National Institute for Research in Reproductive Health, Mumbai (IAEC# 1/03) in accordance with the guidelines of a committee for the purpose of Control and Supervision of Experiments on Animals (CPCSEA) established by Govt. of India on animal care.
Cell lines
P815 (c-Kit expressing murine mastocytoma cells) and ESE14TG2α (c-Kit expressing embryo carcinoma cells) cell lines were procured from National Centre for Cell Science (NCCS), Pune, India, and cultured as described earlier [3]. Bone marrow derived cell line (BMDC) was procured from ATTC and cultured as per the suppliers instructions.
Design of pG1-Kit-ORF-GFP transgene constructs.
For c-kit promoter amplification, genomic DNA was isolated (Quiagen DNA mini Prep) from the testes of adult mice and expected 302bp PCR product was obtained using promoter specific primers (F5´- AGGGAGAGTGCTAGGAGGAA-3´; R 5´-CGCGGTGGCTGCGCT AGA CT-´3). For c-Kit gene ORF amplification, total RNA was extracted from the testes of 10 dpp mice and cDNA was prepared using the iScript cDNA synthesis kit. An expected size of 2937bp c-Kit gene product (excluding stop codon) was amplified by RT-PCR using gene specific primers (F 5´-ATGAGAGGCGCTCGCGGCGC-3´; R 5´- GGCATCTTCGTGCACGAGCA -3´). Next c-Kit promoter and c-Kit gene were cloned into pMosBlue vector and transformed into E.coli competent cells [16]. The presence of the insert was confirmed by colony PCR and validation of the sequences was carried out at the Institutional central DNA sequencing facility. A 7.4 kb pG1-Kit-ORFGFP transgene construct was designed, which contains 4.4 kb c-Kit expression cassette (302 bp c-Kit promoter, 2937bp of c-Kit gene, a 780 bp sequence from the GFP reporter gene, 200 bp SV40 poly-A tail and 200 bp plasmid regulatory sequences). For making the final construct, these transgene elements were orderly cloned in pG1 vector (ATCC, # 37305) and confirmed the presence of each insert by DNA sequencing [17]. The Mlu-1 and Apa-1 digested linearized plasmid insert was introduced into SSCs by electroporation (EP). To rule out nonspecific expression of c-Kit in SSCs, three control-GFP constructs were designed: (1) control GFP-encoding construct lacking c-Kit promoter and c-Kit-ORF. This ~1.1 kb insert consists of a 780 bp sequence from the GFP reporter gene, 200 bp SV40 poly-A tail and 200 bp plasmid regulatory sequences, (2) control GFP-encoding construct lacking c-Kit promoter. This ~4.1 kb insert consists of 2937 bp c-Kit-ORF , a 780 bp sequence from the GFP reporter gene, 200 bp SV40 poly-A tail and 200 bp plasmid regulatory sequences and 3) control GFP-encoding construct lacking c-Kit –ORF. This ~1.4 kb insert consists of 302 bp c-Kit-ORF, a 780 bp sequence from the GFP reporter gene, 200 bp SV40 poly-A tail and 200 bp plasmid regulatory sequences.
In vitro transient transfection of pG1-c-Kit-ORF-GFP transgene constructs in P815 and ES-E14TG2α cells
To determine whether the in vitro expression efficiency of 7.4 kb pG1-c-Kit-GFP transgene fusion construct is under the control of 302 bp c-Kit promoter, P815 and ES-E14TG2α cells (1×106/well) at ~80 % confluence were transfected using Lipofectamine reagent [3]. At 72 hrs post transfection, P815 and ES-E14TG2α cells were washed with PBS (pH 7.4) and grown on glass cover slips in a 6 well plates, fixed for 10 min in 4% paraformaldehyde-PBS and observed under fluorescent microscope using GFP filter (515 nm). To rule out nonspecific expression, ES-E14TG2α cells were transfected with 4.3 kb pG1 control vector (3.2 kb vector backbone and a 780 bp sequence from the GFP reporter gene, 200 bp SV40 poly-A tail and 200 bp plasmid regulatory sequences). The fluorescence images were obtained using a digital camera (PM-10SP, Olympus).
Culture of spermatogonial stem cells (SSCs) isolated from Wv/Wv mutant mice after introduction of 4.4 kb c-Kit-ORFGFP transgene insert
Donor undifferentiated SSCs were isolated from Wv/Wv mutant mice testes using a two-step enzymatic digestion followed by laminin selection protocol [18,19]. Our results and previous reports by others [20,21] suggests that the SSCs enriched by this method contain more than 90% undifferentiated SSCs. These cells (~105) were resuspended in DMEM containing 10% FBS and transferred into a sterile electroporator cuvette (4 mm). The c-Kit-ORF-GFP insert in 10 μl of PBS (2 μg) was introduced into SSCs. same protocol was followed to introduce all the three control-GFP inserts into SSCs. To enrich control and c-Kit-GFP transgene insert introduced SSCs, they were cultured for 48 hrs in the absence or in the presence of growth factors like leukemia inhibitory factor (LIF), glial cell derived neurotropic factor (GDNF) and bovine fibroblast growth factor (bFGF). To determine the differentiation status, cultured SSCs were analyzed for c-Kit expression by indirect immunofluorescence.
Immunofluorescence evaluation of busulfan treated mice testis
Testicular cross sections of 5 μm were cut from prefixed tissue blocks and deparaffinized. After blocking non-specific binding sites with PBS-BSA, sections were incubated overnight at 4°C with 1:100 dilution of mouse anti-human c-Kit monoclonal antibody (SantaCruz, USA). Following three washings in PBS, the slides were incubated with FITC conjugated goat anti-mouse secondary antibody at a dilution of 1:500 for 1 hr at 37°C. The slides were counterstained with nuclear stain, DAPI. After washing with PBS, slides were mounted with Prolong gold anti-fade reagent (Invitrogen) and images were captured by Laser scanning confocal microscope (LSCM) (Zeiss, 510 META, Germany) (X40) at our Institute Central facility. Slides incubated with secondary antibody alone considered as negative controls.
Flowcytometry analysis
Flow cytometry was performed on a FACS vantage flow cytometer (Becton Dickinson, NJ, USA) to evaluate the surface expression of c-Kit protein in SSCs. Based on initial optimization results, the cells (1×105/ well) were transfected with 10 μg of 4.4 kb c-Kit-ORF-GFP transgene as well as 1.1 kb control inserts. Transfected cells were washed twice with DMEM, and analyzed at 72 hrs post- transfection. Excitation of cells was performed with an argon ion laser at a wavelength of 488 nm and the emission of the green fluorescence was detected using a band pass filter of 530/30 nm. Data was collected for a minimum of 10,000 cells per sample. Fluorescence histograms were generated after gating the cell population using cell quest software (http:// facs.scripps.edu). Channels M1 and M2 represented low intensity and high-intensity staining, respectively.
Western blotting
The total protein content of the testicular lysates was determined in wild type and busulfan treated mice using BSA as standard [22]. Equal amount of testicular protein (20 μg/well) was resolved as per the standard protocols using 10% SDS-PAGE and transferred onto nitrocellulose membrane [23,24]. The blots were incubated with mouse anti-human c-Kit monoclonal antibody (SantaCruz, USA) at a dilution of 1:100 in PBS-NFDM followed by incubation with goat anti-mouse HRP conjugated secondary antibody at a dilution of 1:1000 in 1% PBSNFDM. The same protocol was followed to determine the expression of GFP in c-Kit-ORF-GFP introduced and control-GFP introduced contra-lateral testes on day 56 of post GCT using mouse monoclonal anti-GFP antibody (1:100 dilution; Sigma, USA) and peroxidase conjugated goat anti-mouse secondary antibody (1:1000 dilution; Sigma, USA). Normal mouse serum in place of primary antibody was used as negative control.
RNA extraction and RT-PCR analysis
Total RNA was extracted from the testes of control-GFP insert (1.1 kb) and c-Kit-ORF-GFP transgene insert (4.4 kb) on post transplantation day 56 to determine the expression of germ cell and Sertoli cell specific marker genes as described earlier [24]. The primer sequences used for various genes are given in table 1. First-strand cDNA was synthesized using the iScript cDNA synthesis kit according to the manufacturer’s instructions (Bio-Rad, CA, USA). Cyclophilin-A was used as housekeeping gene.
In vivo injection of control GFP and c-Kit-ORF-GFP transgene inserts into the seminiferous tubules of busulfan treated recipient mice
A total of 18 testes (right side) from 18 mice were introduced with electroporated undifferentiated SSCs carrying 4.4 kb c-Kit- ORF-GFP transgene insert. The 18 contra-lateral testes were divided into three groups each consists of six testes and were injected with control-GFP inserts lacking either c-Kit promoter (4.1 kb) or c-Kit- ORF (1.4 kb) or both (1.1 kb). To obtain an enriched population of SSCs, they were isolated from all the three control and c-Kit-ORFGFP transgene introduced testes and cultured for 48 hrs in the special medium containing growth factors. SSCs were transplanted into the seminiferous tubules of busulfan treated recipient mice via rete as described previously [21]. Approximately 10-15 μl of the cell suspension was used to fill at least 75–85% of the seminiferous tubules in the right side testes (n=18). Same volume of cell suspension from three control-GFP groups was injected into the contra-lateral testes (n=18). Testes were directly observed under microscope using GFP filter on day 56 of post GCT. To assess the colonization efficiency of transplanted SSCs, mice (n=3/group) on day 56 of post GCT were sacrificed by CO2 asphyxiation. Testes were collected and subjected to serial cryo-sectioning. In a random sections (5 μm) from the middle part of the testis, a minimum of 50 cross sections of the seminiferous tubule were observed directly under a fluorescent stereo microscope (Nikon, model # SMZ1000) using a GFP filter for the presence of SSCs. On post GCT day 56, testes from right side (n=4/group) as well as the contra-lateral (n=4/group) were dissected from the mice and SSCs were isolated for the determination of germ cell specific marker genes as discussed above.
Results
Construction of pG1-c-Kit-ORF-GFP transgene constructs
A 7.4 kb pG1-c-Kit-ORF-GFP fusion c-Kit transgene cassette has been designed. The orientation of the c-Kit promoter and c-Kit-ORF in pG1-c-Kit-ORF-GFP vector was confirmed by restriction digestion and DNA sequencing. A 4.4 kb Mlu-1 and Apa-1 digested linearized plasmid insert was used for in vivo expression analysis. To rule out any non-specific expression of plasmid regulatory elements and reporter gene, we designed three control GFP-encoding inserts lacking c-Kit promoter and c-Kit-ORF (1.1 kb) or c-Kit promoter (4.1 kb) and c-Kit –ORF (1.4 kb) as discussed under the section 2.3 in Material and Methods. The GFP protein did not altered the function of c-Kit protein. This has been confirmed by functional assay wherein SSCs carrying 4.4 kb c-Kit-ORF-GFP insert were introduced into recipient infertile mice by GCT.
In-vitro expression of 7.4 kb pG1-c-Kit-ORF-GFP transgene construct in P815 and ES-E14TG2α cells
The c-Kit gene is known to be expressed by several cells like bone marrow stem cells, mast cells and melanocytes. To determine the expression efficiency and specificity of 7.4 kb pG1-c-Kit-ORF-GFP transgene construct, c-Kit expressing P815 cells and ES-E14TG2α cells were transfected with 10 μl (2 μg) of the construct and analyzed for GFP-driven c-Kit expression at 72 hrs post transfection. The results revealed that 85-90% of P815 cells and ES-E14TG2α cells showed c-Kit expression as compared to the cells transfected with 4.3 kb control-GFP construct, indicating 302 bp c-Kit promoter is able to drive specific c-Kit expression (Figure 1). As expected, the bone marrow derived dendritic cells (BMDC) did not show c-Kit expression (Data not shown).
c-Kit-ORF-GFP transgene insert introduced SSCs were differentiated in vitro
SSCs which carry c-Kit-ORF-GFP insert was prepared by introducing 10 μl of sterile PBS containing 2 μg of 4.4 kb linearized DNA by electroporation. 10 μl of sterile PBS containing 2 μg of each linearized construct was introduced into SSCs isolated from Wv/Wv mutant mice by electroporation. These SSCs were enriched by culture for 48 hrs as discussed under section 2.5 in Material and Methods. To know whether the electroporated SSCs were differentiated into spermatogonial cells (SGCs), they were divided into two parts, one part has been cultured in the modified medium containing growth factors (LIF, GDNF and bFGF), as expected the SSCs did not differentiate into SGCs as these cells showed lack of c-Kit expression (data not shown). The other parts of SSCs cultured in the absence of growth factors, were differentiated into SGCs which showed significant c-Kit expression on cell surface (Figures 2a and 2b). These results were in agreement with data obtained using flowcytometry, which showed 58.13 % of differentiated SSCs transfected with 4.4 kb c-kit-ORF-GFP insert were expressed c-Kit protein as compared to 1.58% of SSCs transfected with 1.1 kb control insert (Figures 2c and 2d).
Busulfan treatment abrogated c-Kit mRNA and protein expression in recipient mice testis
Busulfan, a DNA-alkylating agent that destroys proliferating cells frequently was used to deplete germ cell population before GCT in recipient mice testes. Immunofluorescence studies revealed that treatment of one month old male mice treated with busulfan resulted complete ablation of testicular germ cells (Figure 3A). C-Kit mRNA (Figure 3B) and protein (Figure 3C) expression was undetectable in the testes of busulfan treated mice as compared to wild type control. However, the expression of Sertoli cell marker genes, GATA-1 and PEM-1 were observed in the testes of busulfan treated mice, indicating Sertoli cell population was not significantly altered in busulfan treated mice (Figure 3D).
SSCs having c-Kit-ORF-GFP transgene insert were colonized and differentiated into other germ cell lineage in the recipient mice testis
Eighteen right side testes (n=18) were injected with electroporated undifferentiated SSCs carrying 4.4 kb c-Kit-GFP transgene insert. Of the 18 right side testes directly examined under fluorescent microscope using GFP filter on post GCT day 56, SSCs from 14 testes (78%) showed colonization and differentiation in the seminiferous tubules (Figures 4a-4d). The contra-lateral testes (n=18) were divided into three groups, each consists of six testes. The first group of six contra-lateral testes was introduced with 1.4 kb control-GFP insert lacking c-Kit-ORF. Seminiferous tubules of these mice showed c-Kit promoter driven GFP protein expression (Figures 4e-4h). Second group of six contralateral testes were injected with 4.1 kb control-GFP insert lacking c-Kit promoter (Figures 4i-4l). Third group of six contra-lateral testes were injected with 1.1 kb control-GFP insert lacking c-Kit promoter & c-Kit- ORF and analyzed on day 56 post GCT ( Figures 4m-4p). Seminiferous tubules of both group two and three mice did not show GFP protein expression. To support these observations, RT-PCR and Western blot analysis were performed to determine whether the differentiated SGCs were derived from the transplanted SSCs. We observed that germ cells marker genes such as Oct-4(466 bp), c-Kit (403 bp), Rbm1 (209 bp), Pgk-2(353 bp), Hils-1 (218 bp), Gata-1 (242 bp), Pem-1(566 bp), Lhr (215 bp) and Tnp2 (255 bp) genes were expressed in the testis of wild type and c-Kit-ORF-GFP transgene construct introduced SSCs. However, expression of Oct-4, c-Kit, Rbm- 1, Pgk-2, Hils-1 and Tnp-2 genes were absent in the testes of control-GFP insert introduced mice. In contrary, the expression of Gata-1, Pem-1 (Sertoli cell marker) and Lhr (Leydig cell marker) genes was observed in contra-lateral testes, which were introduced with 1.1 kb control-GFP insert (Figure 5).
Further, we determined the expression of GFP mRNA in the testes of recipient mice on post GCT day 56 by RT-PCR. The results revealed that 310 bp GFP transcript was observed in the testis of c-Kit- ORF-GFP insert introduced testis but not in the contra-lateral or wild type mice testis. Western blot results showed that anti-GFP antibody identified 172 kDa c-Kit-GFP fusion proteins (Figure 6). Conversely, anti-GFP antibody did not recognize GFP protein in 1.1 kb control- GFP introduced contra-lateral testes. The anti-GFP antibody also did not recognize any GFP related proteins in the testes of wild type mice.
Discussion
Spermatogenesis is characterized by sequential steps of cell proliferation and differentiation of SSCs resulting in the continuous production of spermatozoa. SSCs are known to occupy a special environmental location so called niche, generated by neighboring cells to enable SSCs to undergo differentiation [25]. It is documented that when SSC divide, only one daughter cell remains in the niche as a stem cell and the others would differentiate unless another niche is available. Because Sertoli cells which provide the niches for germ cells, the number and health of these cells is the key factor that decides the rate of SSCs proliferation and differentiation [14].
The results of the present study revealed that SSCs carrying 4.4 kb c-Kit-GFP transgene insert were able to colonize in the testes of recipient mice suggesting transgene insert containing 302 bp c-Kit promoters is sufficient to drive c-Kit expression in vivo. The study demonstrated that in 14 out of 18 testes that received SSCs were colonized and differentiated in the testes of busulfan treated infertile recipient mice. In the remaining 4 testes, c-Kit-ORF-GFP expression in SSCs was absent may be due to the lack of support from the stem cell niche. However, seminiferous tubules of the contra-lateral testes did not have GFP expressing SSCs, suggesting specificity and genomic integrity of c-Kit-ORF-GFP transgene insert. These results were in agreement with earlier reports wherein the authors demonstrated resumption of spermatogenesis [14,26] and the donor haplotype was passed on to the offspring when testicular germ cells from normal mice were transplanted into the testes of busulfan treated infertile mice [21]. As we are aware, majority of transplantation experiments performed to date were done with a mixed population of germ cells [26]. To the best of our knowledge, we demonstrated for the first time that transplanted SSCs were colonized and differentiated in the testis of recipient infertile mice.
In the testis, SSCs are located in niches on the basement membrane of the seminiferous tubule enclosed by the basal lamina, the Sertoli cells and the tight junctions between Sertoli cells. The number of these niches would determine the number of SSC survival and function [14,18]. Our RT-PCR results demonstrated that Sertoli cells persist in the busulfan treated mice testis as observed by the expression of Sertoli cell marker genes such as GATA-1 and PEM-1. Therefore, stem cell niche or microenvironment is thought to be formed on the basement membrane surrounded by the Sertoli cells. In their classical experiments, Ogawa et al [21] have demonstrated that male Sl/Sl-d mice produce SSCs, but lack stem cell factor (SCF) expression in Sertoli cells. In contrast, the testes of mutant mice Wv/Wv do not develop SGCs, due to the lack of functional c-Kit receptor. Nonetheless, earlier findings suggested that Wv/Wv mice testes have the population of SSCs, wherein the function of c-kit signaling activity is impaired due to point mutation in the tyrosine kinase domain of c-Kit. In our studies these SSCs were able to colonize and resume the function of proliferation and differentiation in the presence of c-Kit-ORF-GFP transgene construct.
The characterization of the colonized SSCs results revealed that SSCs were differentiated into germ cell lineages as determined by various marker genes of spermatogenesis. Furthermore, we also confirmed the newly differentiated germ cells are truly derived from the transplanted SSCs. Western blot results demonstrated the presence of 172 kDa c-Kit- ORF-GFP fusion proteins in the testes of recipient mice and its absence in contra-lateral testes suggests that transplanted SSCs were differentiated in the infertile mice testis. Studies are in progress to determine whether or not the direct introduction of 4.4 kb c-Kit-ORF-GFP insert into the testis of Wv/Wv mice will induce differentiation of SSC population. Based on the present observations, we conclude that on a proper migration of donor Wv/Wv SSCs, in a favorable testicular environment can colonize and differentiate into germ cell lineage. This clinically relevant finding raises the possibility for treatment of male infertility.
Conclusion
The present study demonstrated that SSCs obtained from Wv/Wv mutant mice testis can be made functional in vivo with the introduction of 4.4 kb c-Kit-ORF-GFP transgene insert. Transplantation studies revealed that SSCs carrying this insert were colonized and differentiated in the testes of busulfan treated recipient mice. The strong expression of c-Kit-ORF-GFP fusion protein in differentiated SSCs raises the possibility of using these cells to establish a specific cell line that might have germline characteristics. Consistent with our transplantation studies, the present results suggests that a clear role for c-Kit in SSCs colonization, proliferation and differentiation during spermatogenesis in mice. If these observations stand the test of the time, one of the causes of male infertility could be suggested and investigated.
Acknowledgements
We thank the Director, NIRRH for the encouragement to carry out this work. This work was supported by a grant from the Department of Science and technology (DST) and Indian Council of Medical Research (ICMR), New Delhi to KVRR (NIRRH/MS/ 64 /2012). We also thank ICMR and DST, New Delhi for providing senior research fellowships to APS and SK respectively.
Conflicts of interest
The authors hereby declare that there are no conflicts of interest (financial or otherwise) that could be perceived as prejudicing the impartiality of the research/ work reported in the current study.
References

Tables and Figures at a glance

Figure
Table 1

 

Figures at a glance

Figure Figure Figure
Figure 1 Figure 2 Figure 3
Figure Figure Figure
Figure 4 Figure 5 Figure 6
Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11651
  • [From(publication date):
    July-2013 - Aug 19, 2017]
  • Breakdown by view type
  • HTML page views : 7891
  • PDF downloads :3760
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords