alexa Evaluation of Probiotic Potential of Stress Tolerant Saccharomyces cerevisiae and Development of Economically Viable Media for Maximum Growth | OMICS International
ISSN: 2157-7110
Journal of Food Processing & Technology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Evaluation of Probiotic Potential of Stress Tolerant Saccharomyces cerevisiae and Development of Economically Viable Media for Maximum Growth

Reethu Narayanan, K. Naveen Reddy and Ch. Pavana Jyothi*

Department of Microbiology & Food Science and Technology, GITAM Institute of Science, GITAM University, Visakapatnam, India

*Corresponding Author:
Ch. Pavana Jyothi
Department of Microbiology & Food Science and Technology
GITAM Institute of Science, GITAM University
Visakapatnam, India
Tel: 91 9392466777
E-mail: [email protected]

Received date: June 28, 2012; Accepted date: August 18, 2012; Published date:August 25 2012

Citation: Reethu Narayanan, Naveen Reddy K, Pavana Jyothi Ch (2012) Evaluation of Probiotic Potential of Stress Tolerant Saccharomyces cerevisiae and Development of Economically Viable Media for Maximum Growth. J Food Process Technol 3:178. doi:10.4172/2157-7110.1000178

Copyright: © 2012 Reethu Narayanan, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Food Processing & Technology

Abstract

The aim of this study is to characterize the probiotic potential of Saccharomyces cerevisiae MTCC 174, 3821 along with two yeast strains (GSM 3 and 9) isolated from fruit waste and toddy samples respectively. The efficiency of probiotic organisms are tested in vitro under the simulating stress conditions present in gastrointestinal tract i.e. acid and alkaline tolerance, bile salts survivability, thermo tolerance and osmo tolerance. Saccharomyces cerevisiae MTCC 3821 was able to tolerate temperature 43°C and GSM 3 tolerates (isolated yeast) up to 45°C, both the strains are able to tolerate pH range 2 to 8. Saccharomyces cerevisiae MTCC 3821, 174 and isolated yeast (GSM 3 and GSM 9) resisted bile salts concentration of 0.5% to 2% and survived in 30% glucose concentration. Effect of various carbon and nitrogen sources was studied on all the four strains. MTCC 3821 and GSM 3 produced good biomass of 6 g/L in sucrose, 5 g/L in beef extract and tryptone. Saccharomyces MTCC 3821 has also shown maximum biomass of 11.45 g/L (dry wt.) in developed combinational medium consisting of jaggery and beef extract. Based on 18s rRNA sequencing GSM 3 and GSM 9 were identified as Candida tropicalis. Among these organisms Saccharomyces cerevisiae MTCC 3821 is selected for further studies because the ability of the strain to tolerate stress conditions present in gastrointestinal tract (temperature-42°C, bile concentration 2%, pH-2).

Keywords

Saccharomyces cerevisiae; Probiotics; Gastrointestinal tract; Jaggery; Bile salts; Biomass

Introduction

Probiotics are defined as “a live microbial feed supplement which beneficially affects the host animal by improving its intestinal microbial balances” [1]. Probiotics are widely used in pharmaceutical products and fermented dairy products such as yogurt, cheese, fruit juice [2], vegetable juice [3], icecream [4]. Probiotics when ingested adequately exert beneficial effects on host health. These effects include immune modulation, prevention of diarrhea and inflammatory bowel disease, [5] prevention of enteric infections, improvement of intestinal flora [6,7]. They are able to produce water-soluble vitamins like thiamine, folic acid, and biotin [8] and antimicrobial compounds such as bacteriocins [9].

Currently used probiotics belong to prokaryotes. These include lactic acid bacteria, Bifidobacteria, Streptococci, Enterococci. Among prokaryotes Lactobacillus and Bifidobacterium strains are most extensively studied [7]. Eukaryotic probiotic properties are completely different from prokaryotes. There are few advantages of eukaryotes over prokaryotes. For example eukaryotes are resistant to antibiotic like sulfamides and other antibacterial agents [10]. Eukaryote microbes have ten times surface area than bacteria therefore greater protection to intestinal cell walls. Among eukaryotes yeast has been extensively studied. Many yeast such as Debaryomyces hansenii, Kluyveromyces lactis and Yarrowia lipolytica are frequently found in dairy foods. These yeast show beneficial effect such as inhibition of spoilage microorganism and develop aroma to the product [11]. But eukaryotic studies on probiotic point of view are conducted in limited manner [12,13]. Saccharomyces is yeast widely found in nature and used in dairy foods. The probiotic yeast commercially used for human application is Saccharomyces boulardii. For animal application Saccharomyces cerevisiae is generally used. It is single celled non pathogenic microbe. It is widely used in fermentations it occurs in sugar rich materials such as grapes, sugarcane, fruit wastes. They have the ability to utilize and grow in different sugars (glucose, sucrose, maltose etc.). The US Food and Drug Administration have given Saccharomyces cerevisiae the GRAS status (generally recognized as safe) [14].

in vitro assessment of microorganism for probiotic application has been proposed by Conway 1996 [15], Ouwehand et al. [16]. The strain must tolerate the wide stress conditions in gastro intestinal tract (GIT). It should tolerate the low pH bile salts in GIT. The tolerance to acid, bile enables them to survive, grow and perform beneficial action in the host GIT. It should show thermo tolerance because in rumen of ruminants the temperature is 42°C [17], tolerance to osmotic stress and posses antimicrobial activity.

Therefore in the present study few yeast strains were isolated, screened and compared with standard cultures (MTCC) which have ability to withstand stress conditions in gastro intestinal tract (GIT). The effect of different carbon and nitrogen sources on the biomass production was also attempted in the selected yeast strains (Saccharomyces cerevisiae MTCC 3821 and 174), and development of economically viable media for maximum growth of selected probiotic Saccharomyces cerevisiae.

Materials and Methods

Microorganisms and culture conditions

Standard yeast strain Saccharomyces cerevisiae MTCC 174, 3821 were procured from Microbial Type Culture Collection, Institute of Microbial Technology, Chandigarh, India. They were activated in yeast extract peptone dextrose media (YEPD). Yeast strains were incubated at 30°C. Regular sub culturing was done for every 15 days.

The collected samples were diluted to ten folds in autoclaved distilled water and from this, 100 micro liters of diluted samples were plated and the YEPD plates were incubated at room temperature for 48 hrs. Yeast extract peptone dextrose medium (YEPD) containing g/L:10 yeast extract, 20 peptone, 20 dextrose (+20 agar for plate cultures), 500 mg of chloramphenicol [18]. pH was adjusted to 5.5 with 10 N sulphuric acid and cultures incubated at 30°C for 48 hrs. Twenty yeast strains were isolated from various samples (fruit waste, toddy sample, wine, sugarcane juice, bakery waste. Among these two yeast strains (GSM 3 and 9) were selected for further studies, these two strains (GSM 3 and 9) were isolated from fruit waste and toddy samples respectively.

Screening for probiotic characteristic

Thermo tolerance: Overnight culture of yeast strains (MTCC 3821, 174 and isolated yeast strains) 1% v/v were inoculated into 100ml YEPD broth, incubated at different temperatures 30°C, 37°C, 40°C, 41°C, 42°C, 43°C, 44°C and 45°C for 24-48 hrs. Growth was measured using spectrophotometer (HITACHI, JAPAN) at 660 nm against control without culture broth and viability was determined by inoculating the culture in YEPD agar plates.

Acid and alkaline tolerance: Overnight culture of yeast strains, 1% v/v were inoculated into 100 ml YEPD broth, broth was adjusted to pH 2 to pH 8 using 1 N HCl and 1 N NaOH to determine acid and alkaline tolerance and incubated at 37°C for 24 hrs. Growth was measured using spectrophotometer at 660 nm and viability was determined by inoculating the culture in YEPD agar plates. pH 2 corresponds to pH present in stomach and pH 8 corresponds to pH present in intestine. Acid and alkaline tolerance, bile tolerance and osmotolerance experiments were conducted at 37°C because these probiotic organisms are also useful to human consumption.

Bile tolerance: Overnight culture of yeast strains, 1% v/v were inoculated into 100 ml YEPD broth, broth was supplemented with synthetic bile salts (Qualigens) 0.5%, 1%, 2%, and incubated at 37°C for 24 hrs. A control was maintained without bile salts. Growth was measured using spectrophotometer at 660 nm and viability was determined by inoculating the culture in YEPD agar plates.

Osmotolerance: Overnight culture of yeast strains, 1% v/v were inoculated into 100 ml YEPD broth, broth containing 5%, 10%, 15%, 20%, 25%, 30% of dextrose was added instead of 3% glucose. Incubated for 24 hrs at 37°C. Growth was measured using spectrophotometer at 660 nm and viability was determined by inoculating the culture in YEPD agar plates.

Effect of various carbon sources on growth of yeast strains: Standard and isolated yeast strains (MTCC 3821, 174 and GSM 3 and 9) were grown in standard YPD broth (Dextrose 3%, peptone 2% and yeast extract 1%) supplemented with different carbon sources such as sucrose, maltose, fructose and lactose and inoculated with overnight yeast cultures 1% v/v separately and incubated at 30°C for 48 hrs.

Effect of various nitrogen sources on growth of yeast strains: Standard and isolated yeast strains (MTCC 3821, 174 and GSM 3 and 9) were grown in standard YPD broth (Dextrose 3%, peptone 2% and yeast extract 1%) supplemented with different nitrogen sources such as beef extract, tryptone, KNO3, CaNO3, NH4Cl, (NH4)2SO4 and urea, inoculated with overnight yeast cultures 1% v/v separately and incubated at 30°C for 48 hrs.

Identification of yeast isolates: Isolated yeast strains GSM 3 and GSM 9 were conducted for 18s rRNA gene sequencing to Macrogen South Korea. The primers used are ITS1 (sequence 5 to 3 Universal TCCGTAGGTGAACCTGCGG), ITS4 (sequence 5 to 3 Universal TCCTCCGCTTATTGATATGC).

Screening of economically viable substrates for Saccharomyces cerevisiae growth: The production of biomass using economically viable substrates is useful to industrial needs. Therefore, Saccharomyces cerevisiae MTCC 3821 and MTCC 174 (1% v/v) biomass production was determined by various economically viable substrates. The economically viable substrates such as jaggery, pods of Prosifus julifera, banana peel, orange peel and coconut deoiled cake, mixed fruit waste and vegetable waste were used for biomass production. Except jaggery (jaggery is easily dissolved in water) all other raw materials were crushed and boiled in water for 1 hr. After 1 hr the media were cooled, filtered and filtrate was made up to their respective volume and autoclaved separately. Standard strains of Saccharomyces cerevisiae MTCC 3821 and MTCC 174 (2% v/v) inoculated into 5% different raw materials and incubated for 48 hrs at 30°C at 150 rpm agitation in orbital shaker. After 48 hrs of incubation the broth were centrifuged at 2000 rpm for 15 minutes and pellet was dried in oven at 40°C and weighed on weighing balance (SHIMADZU).

Growth of Saccharomyces cerevisiae on raw materials supplemented with 1% carbon and nitrogen sources

Among above substrates three substrates were selected (jaggery, pods of Prosifus julifera, and fruit waste) based on the highest biomass obtained. These raw materials were supplemented with 1% different carbon and nitrogen sources separately. The carbon sources (maltose, glucose, fructose and lactose) and nitrogen sources (beef extract, tryptone, peptone, urea, KNO3, CaNO3, NH4Cl, (NH4)2SO4). Overnight culture of yeast strains, 1% v/v were inoculated into media and incubated for 48 hrs at 30°C at 150 rpm agitation in orbital shaker. After 48 hrs of incubation the broth were centrifuged at 2000 rpm for 15 minutes and pellet was dried in oven at 40°C and weighed on weighing balance (SHIMADZU).

Results

Thermo tolerance

Thermo-tolerance was measured in terms of turbidity and viability of the culture. GSM 3 showed turbidity and viability up to 45°C. S.cerevisiae MTCC 3821 and GSM 9 showed visible turbidity and viability at 43°C, whereas S.cerevisiae MTCC 174 showed turbidity and viability up to 42°C. The details of the results (average of triplicates) are given in Figure 1.

food-processing-technology-temperature-growth

Figure 1: Effect of temperature on growth of yeast.

Acid and alkaline tolerance

S.cerevisiae MTCC 3821, 174 isolated GSM 3 and 9 showed significant growth in pH 2 and all strains (S.cerevisiae MTCC 3821, S.cerevisiae MTCC 174, GSM 3, and GSM 9) survived up to alkaline pH 8. The details of the results (average of triplicates) are given in Figure 2.

food-processing-technology-Effect-growth

Figure 2: Effect of pH on growth of yeast at 37 °C.

Bile tolerance

All strains (S.cerevisiae MTCC 3821, 174, GSM 3 and 9) were able to survive in presence of different concentration of bile salts. The details of the results (average of triplicates) are given in Figure 3.

food-processing-technology-Effect-bile-salts

Figure 3: Effect of bile salts on growth of yeast at 37°C.

Osmotolerance

All organisms (S.cerevisiae MTCC 3821, 174, GSM 3 and 9) were able to tolerate upto 30% of glucose. S.cerevisiae MTCC 3821 and GSM 3 growth was increased with sugar concentration up to 20% then decreased, where as S.cerevisiae MTCC 174 and GSM 9 was increased with sugar concentration up to 15% then decreased. All organisms shows viability up to 30% of glucose. The details of the results (average of triplicates) are given in Figure 4.

food-processing-technology-Effect-glucose

Figure 4: Effect of glucose on growth of yeast at 37°C.

Effect of various carbon sources on growth of yeast strains

The effects of carbon sources on growth of yeast strains are moderate. All four yeast strains (standard and isolated yeast strains) were shown slightly increased biomass in medium supplemented with 1% sucrose. Among them GSM 3 has shown biomass 6.87 g/L followed by S.cerevisiae MTCC 3821 (6.81 g/L), S.cerevisiae MTCC 174 (6.74 g/L) and GSM 9 (6.73 g/L). In maltose and fructose GSM 9 has shown less improvement of biomass of (6.61 g/L) and (6.50 g/L) respectively. Medium supplemented with lactose and starch production of biomass were shown similar results with control. Therefore lactose and starch are not utilized by yeast strains. The details of the results (average of triplicates) are given in Figure 5.

food-processing-technology-various-carbon-sources

Figure 5: Effect of various carbon sources on growth of yeast strains.

Effect of various nitrogen sources on growth of yeast strains

All four yeast strains were shown moderate biomass production in various nitrogen sources. Among them medium supplemented with beef extract increase the biomass production of GSM 3 (6.48 g/L), GSM 9 (6.38 g/L), MTCC 3821(6.41 g/L), MTCC 174 (6.43 g/L). Medium supplemented with tryptone moderate improvement of biomass was observed to all strains. The results shows as follows GSM3 (6.45 g/L), GSM9 (6.25 g/L), MTCC 3821(6.32 g/L), MTCC 174 (6.28 g/L). Medium supplemented with nitrogen sources such as KNO3, CaNO3 and urea shows similar or less improvement of biomass when compared with the control. These organisms both isolated (GSM 3, 9) and standard strains S.cerevisiae (MTCC 3821, 174) shows strain variability. The details of the results (average of triplicates) are given in Figure 6.

food-processing-technology-nitrogen-sources

Figure 6: Effect of various nitrogen sources on growth of yeast strains.

Identification of isolated yeast strains

Isolated yeast strains GSM 3 and GSM 9 were identified as Candida tropicalis by 18s rRNA sequencing. These two yeast isolates confirmed as Candida tropicalis by Macrogen Corporation, South Korea. Candida tropicalis cannot be used as promising candidate for probiotic application. Candida tropicalis is used for D-xylose fermentation studies. Further probiotic studies were carried out using standard strains of yeast MTCC strains 3821 and 174.

Screening of economically viable substrates for Saccharomyces cerevisiae growth

Two Saccharomyces cerevisiae MTCC 3821 and 174 were grown individually in different economically viable substrates (5% w/v) such as jaggery, Prosifus julifera pods, banana peel, orange peel, coconut deoiled cake, mixed fruit waste and vegetable waste. Among these substrates jaggery, mixed fruit waste and pods were selected based on maximum biomass i.e 6.74 g/L, 4.94 g/L, 4.29 g/L respectively using MTCC 3821. Likewise MTCC 174 has shown maximum biomass of 6.60 g/L, 4.20 g/L, 4.88 g/L in jaggery, Prosifus julifera pods and mixed fruit waste respectively. The details of the results (average of triplicates) are shown in (Table 1).

Substrates Biomass g/L
S.cerevisiae MTCC 174 S.cerevisiae MTCC 3821
Jaggery 6.60 6.74
Pods 4.20 4.29
Fruit waste 4.88 4.94
Vegetable waste 3.72 3.63
Banana peel 3.81 3.80
Orange peel 3.35 3.54
Deoiled Cake 3.69 3.77

Table 1: Screening of economically viable substrates for Saccharomyces cerevisiae biomass production.

Growth of Saccharomyces cerevisiae on raw materials supplemented with 1% nitrogen sources

Based on the above results three substrates were selected (jaggery, pods and fruit waste) 1% different nitrogen sources like beef extract, tryptone, peptone, KNO3, CaNO3, NH4Cl, (NH4)2SO4, urea were supplemented separately for improvement of growth. Among these nitrogen sources, 5% jaggery with 1% beef extract have given highest biomass of 11.45 g/L and 11.12 g/L by MTCC 3821 and MTCC 174 respectively. Medium containing jaggery with trptone shows 10.85 g/l and 10.96 g/l using MTCC 3821 and MTCC 174 respectively. Economically viable substrates supplemented with nitrogen sources gave good results compared with control and individual substrates. These results shows variability of strains as well as utilization of nitrogen sources (Table 2).

Nitrogen source Biomass g/L
Jaggery Mixed fruit waste Pods
MTCC174 MTCC3821 MTCC174 MTCC3821 MTCC174 MTCC 3821
Beef extract 11.12 11.45 9.63 9.75 7.18 7.35
Tryptone 10.85 10.96 9.77 9.87 7.32 7.44
Peptone 10.59 10.24 9.48 9.54 7.10 7.23
NH4Cl 8.75 8.56 7.41 7.37 6.06 5.91
(NH4)2SO4 8.53 8.14 7.37 7.30 5.87 5.76
Urea 7.09 7.04 5.59 5.64 4.17 4.00

Table 2: Growth of Saccharomyces cerevisiae on raw materials supplemented with 1% nitrogen sources.

Growth of Saccharomyces cerevisiae on raw materials supplemented with 1% different carbon sources

The two Saccharomyces cerevisiae (MTCC 3821 and MTCC 174) were grown in jaggery, mixed fruit waste and pods (5% w/v each) were supplemented with 1% different carbon sources such as fructose, glucose, sucrose and maltose separately for improvement of biomass. Among these carbon sources, 5% jaggery supplemented with 1% glucose have given highest biomass of 10.65 g/L and 10.22 g/L by MTCC 3821 and MTCC 174 respectively. Medium containing jaggery with fructose shows 9.52 g/L and 9.42 g/L using MTCC 3821 and MTCC 174 respectively. Economically viable substrates supplemented with carbon sources gave good results compared with control and individual substrates. Among all carbon sources medium supplemented with maltose gave good improvement of biomass in combination with jaggery, but combination with pods it shows least biomass compared with control. Among all the substrates jaggery shows the highest biomass using both MTCC 3821 and MTCC 174 (Table 3).

Carbon Sources Biomass in g/L
Jaggery Mixed fruit waste Pods
MTCC 174 MTCC 3821 MTCC 174 MTCC 3821 MTCC 174 MTCC 3821
Fructose 9.42 9.52 6.23 6.35 5.64 5.78
Glucose 10.22 10.65 7.15 7.29 5.80 5.94
Sucrose 9.35 9.44 6.16 6.10 5.56 5.43
Maltose 8.75 8.56 6.03 5.94 5.49 5.51

Table 3: Growth of Saccharomyces cerevisiae on raw materials supplemented with 1% different carbon sources.

Discussion

Optimum temperature for growth of Saccharomyces cerevisiae is 28-30°C. In rumen temperature is 42°C, therefore if used any probiotic organism in ruminants must tolerate 43°C. Among yeast strains S.cerevisiae MTCC 3821 and isolated yeast GSM 9 were viable at 43°C. These reports are in agreement with Preeyaporn et al. [19] isolated yeast strains which can tolerate 41°C.

According to selection criteria the probiotic microorganism should tolerate the stress conditions of GIT, be viable and reach the site of action [16]. First barrier in the GIT is the acidic condition in stomach. Visible turbidity or biomass in terms of O.D was seen in pH 2 for S.cerevisiae MTCC 3821, 174 and isolated GSM 3 & 9. Bhima et al. [20] isolated S.cerevisiae which was able to tolerate pH 2. In small intestine the pH is 8.5. All strains showed good biomass in terms of O.D at pH 8, when compared to O.D at 7 pH.

Besides acid and alkaline tolerance strains used in probiotic application should withstand bile salts, up to two percent bile salt was used in this study. This two percent bile salt is the extreme concentration obtained during first hour of digestion [21]. All strains showed good growth up to 2%. Psomas et al. [22], Vander aa kuhle et al. [23] and Bhima et al. [20] reported growth of yeast strains in 1% bile salts, Geeta et al. [24] reported, growth of yeast in 2% bile salts. All yeast showed good turbidity in terms of O.D. and biomass in 30% glucose. Bhima et al. [20] reported growth of OBV9 in 30% glucose.

Yeast has the ability to utilize a wide variety of sugars and nitrogen sources. In sucrose highest biomass was recorded for all strains. Sarah et al. [25] in term of O.D recorded highest growth by S.cerevisiae in sucrose and minimum growth in glucose. GSM 3 has shown highest biomass 6.87 g/L in sucrose followed by S.cerevisiae MTCC 3821 (6.81 g/L). Control and 1% lactose showed similar biomass in all strains. This shows all strains are unable to utilize lactose. Control and 1% starch showed similar biomass in MTCC 3821 and 174. Of all the different nitrogen sources used, highest biomass was obtained in beef extract by all strains.

For probiotic application among all strains MTCC 3821 and 174 were selected based on tolerance against GIT stress conditions ( e.g. Temperature-42°C, pH 2 and 2% bile concentration) and GRAS (Generally recognized as safe) status. The biomass production ability of these two strains was observed using economically viable substrates like jaggery, pods, mixed fruit waste, vegetable waste, banana peel, orange peel and coconut deoiled cake. Munawar et al. [26] reported fruit waste extract (10 w/v) for the production of single cell protein. Mahnaaz Khan [27] reported banana skin produced high amount of protein (58.62% /100 g substrate) from yeast. Among these jaggery, pods and mixed fruit waste have given maximum biomass 6.74 g/L, 4.29 g/L, and 4.94 g/L by MTCC 3821 respectively.

Rosma and Cheong [28] reported an increased biomass production with addition of various nitrogen sources to pineapple waste extract (Peptone, yeast extract, NH4H2PO4, (NH4)2SO4, KNO3). Growth of two standard strains (MTCC 3821 and 174) were studied on selected economically viable substrates (jaggery, pods, fruit waste) supplemented with 1% different nitrogen and 1% carbon sources separately. Initially medium containing 5% jaggery and 1% different nitrogen sources like beef extract, tryptone, peptone, urea, NH4Cl and (NH4)2SO4 and different carbon sources (glucose, sucrose, fructose, maltose) were added separately for more biomass production. These nitrogen and carbon sources were common for all the three economically viable substrates. Medium containing 5% jaggery with 1% beef extract have given maximum biomass of 11.45 g/L and 11.12 g/L by MTCC 3821 and 174 respectively. Medium containing 5% Prosifus julifera pods with 1% tryptone have given 7.44 g/L and 7.32 g/L by MTCC 3821 and 174 respectively. Medium containing 5% fruit waste and 1% tryptone gave maximum biomass of 9.87 g/L and 7.32 g/L by MTCC 3821 and 174 respectively. Medium containing 5% jaggery with 1% glucose have given maximum biomass of 10.65 g/L and 10.22 g/L using MTCC 3821 and 174 respectively.

Conclusion

Of all four strains MTCC 3821 was able to tolerate all stress conditions (Temperature-43°C, pH 2 and 2% bile concentration, osmotolerence-30%) and was proved in-vitro. Therefore Saccharomyces cerevisiae MTCC 3821 is an ideal organism for probiotic rumen application and maximum biomass production using economically viable substrate jaggery supplemented with beef extract (11.45 g/L).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 12093
  • [From(publication date):
    September-2012 - Dec 16, 2017]
  • Breakdown by view type
  • HTML page views : 8270
  • PDF downloads : 3823
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version