alexa Food and Feeding Habits of Red Lionfish Pterois volitans from Cuddalore Coast, South East Coast Construction of Radiation Hybrid Panels for Two Major Aquaculture Species: Sturgeon and Oyster | Open Access Journals
ISSN: 2155-9546
Journal of Aquaculture Research & Development
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Food and Feeding Habits of Red Lionfish Pterois volitans from Cuddalore Coast, South East Coast Construction of Radiation Hybrid Panels for Two Major Aquaculture Species: Sturgeon and Oyster

Azzouzi N1,2*, Ennaji MM2, Benchekroun MN3, Rakotomanga M1, Baroillier JF4 and Galibert F1

1Institut Génétique et Développement (UMR 6290) CNRS/Université de Rennes 1, Faculté de Médecine, 35000 Rennes, France

2Laboratore de virologie et Hygiéne & Microbiologie, Faculté des Sciences et Techniques Mohammedia (FSTM) Université Hassan II, 20650 Mohammedia-Casablanca, Marocco

3Laboratoire de Biotechnologie, de l´Environnement et de la Santé, Faculté des Sciences et Techniques Mohammedia (FSTM) Université Hassan II, 20650 Mohammedia-Casablanca, Marocco

4INTREPID (INTensification Raisonnée et Ecologique pour une PIsciculture Durable) (UMR110) Cirad/Ifremer, Campus International Baillarguet, 34398 Montpellier, France

*Corresponding Author:
Azzouzi N
1Institut Génétique et Développement
(UMR 6290) CNRS/Université de Rennes 1
Faculté de Médecine, 35000 Rennes, France
Tel: +(33) 223234782
Fax: + (33) 223234478
E-mail: [email protected]

Received Date: March 22, 2013; Accepted Date: May 24, 2013; Published Date: June 04, 2013

Citation: Galibert F, Azzouzi N, Ennaji MM, Benchekroun MN, Rakotomanga M (2013) Construction of Radiation Hybrid Panels for Two Major Aquaculture Species: Sturgeon and Oyster. J Aquac Res Development 4:185. doi:10.4172/2155-9546.1000185

Copyright: © 2013 Galibert F, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Aquaculture Research & Development

Abstract

The living water jewels have an attractive colored for example a body color, morphology, mode of taking food and have a peculiar characteristic. A number of aquarium fishes the Pterois sp is known to aquarists, while it is easy to breed and very important and interesting tasks of an aquarium keeper is to feed management. Food is playing an important role in maintaining health and preventing diseases. Providing exact diet is essential for fish growth and other activities. Overfeeding or uneaten food contributes to a deteriorating water quality by polluting the water. Some fishes in wild or culturing system are not taken regularly same food and it will be varying due to the inhabitants. The red firefish P. volitans is one of the remarkable fish in marine waters. In the present study, the food and feeding habits of lionfish P.volitans, male and female fishes were observed and due to fishes gut contents were analysis. The different food items were recorded from the guts of P. volitans during the study period. Generally, the food items found in the examined gut contents were grouped into eleven different categories. The male fish of P. volitans stomach contents as identified feed compositions in the following order: viz., Crustaceans >Fish >Zooplankton >Phytoplankton >Miscellaneous >Bivalves >Polychaetes >Gastropods >sand >Nematodes >Digested matter and the female fish of P. volitans stomach contents as identified feed compositions in the following order viz., Crustaceans >Fish >Zooplankton >Phytoplankton >Miscellaneous >Bivalves >Polychaetes >Gastropods >Sand >Nematodes >Digested matter, respectively. The present investigation very much useful for this species to be taken up for aquariums in home or office, hotel, hospital, intensive, semi intensive and mass scale culture practices in anywhere in the world.

Keywords

Sturgeon; Oyster; Radiation hybrid panel; Marker assisted selection

Abbreviations

RH radiation hybrid; MAS marker assisted selection; HPRT hypoxanthine-guanine phosphoribosyltransferase; TK thymidine kinase; CHO Chinese hamster ovary; HAT hypoxanthineaminopterinthymidine medium; WGA whole genome amplification; EST expressed sequence tag

Introduction

Both fish and molluscs are important sources of protein in the human diet [1-3]. Currently, more than half of the fish and molluscs consumed are produced by aquaculture and this percentage may well increase due to environmental constraints and the decline of the natural stock in ocean coastal area. Indeed, according to the Convention on Biological diversity, the extent of coastal fish depletion has nearly doubled every 10 years since 1960 (www.fao.org/docrep/016/ i2727f/i2727f01.pdf). This alarming reality partially explains the development of international projects aimed at determining the genome sequences of fish species, including salmon, trout and tilapia, and molluscs, like the oyster [4]. The genome sequences may allow the identification of genomic markers useful for marker assisted selection (MAS) [5], genomic selection, and more generally the development of “omics” approaches for a better understanding of fish biology and evolution. Over recent years, we have constructed RH panels and corresponding RH maps for three important aquaculture species: seabream (Sparus aurata), seabass (Dicentrarchus labrax) and tilapia (Oreochromis niloticus) [6-8].

RH fish panels have long been considered to be very difficult if not impossible to produce, and only two zebrafish RH panels were produced; both were constructed starting with a permanent zebrafish cell line as donor cells. This source of cells is not optimal, because the genomes of most permanent cell lines are rearranged and therefore do not accurately reflect the genome of the species [9,10]. Here, we report the construction of two RH panels, one for a fish, the sturgeon (Acipender bareii), and the other for a mollusc, the Pacific oyster (Crassosteas gigas). Both are major aquaculture products with an annual production of 4,500 (http://www.fao.org/fishery/culturedspecies/Acipenser_baerii/ fr) and 4,5 million tons, (http://www.fao.org/fishery/culturedspecies/ Crassostrea_gigas/fr) respectively.

Materials and Methods

Panel construction

Juvenile sturgeon (Acipender bareii) averaging 200 g were obtained from Sturgeon SA. Radiation hybrid panels were constructed as previously described [8]. Briefly for each fusion, one fish was killed with an overdose of 2-phenoxyethanol and rinsed briefly in 70% ethanol. Spleens were rapidly dissected and rinsed several times in washing medium (Leibovitz L-15; 1% Penicillin/Streptomycin/Fungizone) then cut into small pieces. The pieces were fragmented with a Potter device and the resulting cell suspensions were γ-irradiated at 3500 rad. The cells were fused with HPRT-derivative CHO cells as previously described [6-8]. Briefly HPRT-derivative CHO cells and splenocytes were mixed in a 1:5 ratio (CHO/splenocyte) in the presence of polyethylene glycol 1500 (Roche, Mannheim, Germany). Cells were seeded in 12-well microplates at a total concentration of 150,000 cells per well and cultivated with HAT medium for 2 to 3 weeks until hybrid clone appearance. Clones were recovered individually and further cultivated under HAT selection in 60 mm diameter Petri dishes. The cells were trypsinised and DNA was extracted from individual clones using the NucleoSpin Tissue kit (Macherey-Nagel, DuÌ?ren, Germany). DNA concentrations were quantified by fluorescence using the Quant-iT Picogreen assay kit and a Qubit spectrofluorometer (Invitrogen, Carlsbad NM, USA). DNA from each hybrid cell line was amplified by a Whole Genome Amplification (WGA) procedure as necessary; in these cases, two separate WGA were performed with 10 ng of DNA each using V2 GenomiPhi kits (GE healthcare, Fairfield CT, USA). WGA products were pooled providing ~10 ug of material for subsequent genotyping. We previously showed that WGA is an important step, which limits or over pass cell culture difficulties while providing a faithful representation of the input DNA [7,8].

Commercial oysters were bought from the market and bathed in seawater for a week. Thereafter, a volume of fresh water equivalent to 10% of the bath volume was added every week for a period of 8 weeks. During this period 1 to 3 oysters died every week. At the end of the adaptation period, living oysters were opened and muscles recovered. Muscles from 6 to 12 oysters were pooled, suspended in 50 ml of sterile diluted seawater and gently dissociated with a Potter device. The samples were centrifuged for 5 min at 1200 rpm and the pellets re-suspended and washed twice in sterile diluted seawater (25% seawater/75% water). Finally, the cell pellet was γ-irradiated at 3500 rads. The irradiated oyster cells were suspended in diluted seawater and counted. CHO derivative cells were added to a ratio of 8/1 (oyster/CHO cells) and allowed to fuse in the presence of polyethylene glycol 1500 (Roche, Mannheim, Germany). The cells were seeded in 12-well microplates and cultivated in HAT and DMEM media, alternately. Two weeks later, the contents of each well were recovered, and the DNA extracted and directly amplified and quantified [8].

Genotyping markers

Sturgeon and oyster expressed sequences (ESTs) and mRNA sequences, and oyster BAC sequences were downloaded from NCBI (http://www.ncbi.nlm.nih.gov). Oligonucleotide primers of 23 nt average length for polymerase amplification (PCR) were designed with Primer3 v0.4.0 software [11]. (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/). Markers, 60 to 150 bp long (including primers) were amplified and electrophoresed on 2% agarose slab gels. Markers were usually genotyped in duplicate with no visible significant difference.

Results

Panel construction

The first step in RH panel construction is the fusion of donor and acceptor cells. To avoid the use of permanent cell lines, we prepared sturgeon donor cells from the spleen organs. Spleen cells present numerous advantages. The spleen is a sort of bag full of splenocytes that can be liberated by very gentle mechanical disruption in L15 Leibovitz medium with a Dounce or a Potter device; thus several hundred millions of splenocytes can be readily obtained and can be directly γ irradiated without the need for cell culture before fusion. The construction of the oyster panel presented two specific difficulties not encountered with the fish panel. Oysters have no spleen organ and, being an open organism, oyster cells are bathed and live in a medium with a naturally high osmotic pressure (NaCl ∼35 g/litre) incompatible with the osmotic pressure suitable for CHO receptor cells (NaCl ∼9 g/litre). To overcome these two difficulties, we tested several oyster organs for their suitability as donor cells. We found that the muscle was appropriate tissue, because, like the fish spleen, it can be gently dissociated in sterile sea water with a Potter device, and a pool of six to nine oyster muscles can provide more than 10×107 cells, sufficient for fusion protocols. Although oysters live mostly in conditions of high osmotic pressure, oysters in their natural environments tolerate a range of different osmotic pressures, for example in the oyster beds where they are immersed during the finishing period, or near estuaries where they may to settle. We therefore tested whether they could adapt to lower osmotic pressure: we immersed oysters in a basin filled with seawater and every week added a volume of tap water equal to one tenth of the total volume. During this adaptation period, some oysters died but most remained viable. After seven weeks of adaptation, the osmotic pressure of the water bath was close to NaCl ∼9 g/litre. More than half (65%) of the muscle cells prepared from adapted oysters tolerated the temperature and the osmotic pressure of the medium in which they were mixed with CHO receptor cells before fusion. Conversely cells prepared from non-adapted oysters did not survive when subjected to the same conditions. Sturgeon and oyster cells prepared as described were irradiated with a dose of 3500 rads, which past experience suggests is suitable for constructing panels of manageable resolution [6-8,12,13]. Following fusions, the cells were incubated in HAT medium to allow the growth of the hybrid cells only. Little is known about the sturgeon and oyster TK and HPRT genes and proteins, so for both donor cell types, we performed two fusions in parallel, one with CHO TK-cells as the receptor cells and the other with CHO HPRT-cells. We then checked the two selection systems for their ability to support the growth of the hybrid cells in the HAT selective medium. Subsequent fusions were made with the CHO HPRT-mutant to construct the sturgeon panel: individual sturgeon hybrid clones were obtained and could be grown. By contrast, no oyster hybrid clones were obtained with either of the two CHO mutants. However, it seemed likely that a small number of hybrid cells could have survived after three weeks under HAT medium in a number of titre plate wells because in the absence of any fusion the bottoms of the wells should be totally clear with no remaining cells. However, the aspect of some of the wells was unusual, but suggestive of the presence of cells. We suspected that there had been cell fusion, but that the TK and the HPRT proteins were produced at only a low level or were poorly active in the CHO context, such that hybrid clones survived but did not grow properly. We therefore modified the protocol of selection: the cells were cultivated in HAT and DMEM media alternately. The aim was to eliminate the oyster cells and the CHO cells but not the hybrid cells during the HAT periods (48 hours) and then allow the hybrid cells to grow during the DMEM periods (48 hours). After two weeks of this selection procedure, the content of each well was independently recovered, and the DNA extracted and amplified with Genomiphi [7,8]. From three fusions for sturgeon we recovered 474 hybrid cell lines and from four fusions for oyster, we recover 168 lines (Table 1).

  Gene used for selection # fusions # hybrid clones Panel size
Sturgeon HPRT 3 474 94
Oyster HPRT 2 77 48
Oyster TK 2 91 46

Table 1: Number of hybrid cell lines obtained with the different fusion and RH panel characteristics.
The number of fusions indicated in this table includes only the productive fusions. There were several attempted fusion before appropriate experimental conditions were found. As it was not known whether the oyster HPRT and TK proteins complement the hamster mutant, we used the two systems in parallel. The working oyster panel was then constituted of 48 HPRT and 46 TK hybrid cell lines. This strategy of using both TK- and HPRT-rescued clones may represent an advantage over using one gene only: markers located close to the TK or HPRT receptor gene cannot be mapped because they are present in all or nearly all the hybrid cells rescued with the corresponding gene.

Panel characterization

The hybrid retention value (the percentage of markers per RH clone) and the marker retention value (the percentage of each individual marker in each hybrid cell) are two metrics that characterize the ability of an RH panel to produce good and useful RH maps [8]. To estimate these two values for our RH lines, we selected from GenBank 48 sturgeon microsatellites and 32 oyster markers composed of ESTs and microsatellites. The banding pattern illustrating the distribution of each of the 48 microsatellite markers in two sturgeon hybrid cell lines is shown in Figure 1a (Figure 1a). Similarly, the distribution of the 32 markers in two oyster hybrid cell lines is shown in Figure 1b (Figure 1b). From these experiments, we selected 94 cell lines to constitute each of the two panels. Briefly we first selected the hybrid clones with each containing between 10% and 70% of the markers that were typed. Then based on the marker retention values, we added to these first groups of cells various other clones such that the overall retention values for markers poorly represented in the panel were increased (Figures 2a-2d and Table 2). The capacity of the sturgeon and oyster panels to link markers, and make RH groups and RH maps was tested by typing a number of pairs of markers with known nucleotide inter-distances. We retrieved from GenBank the nucleotide sequences of 12 sturgeon mRNAs (Table 3), designed oligonucleotide pairs at their extremities and performed PCR amplification with each of the 94 cell lines of the sturgeon RH panel. The PCR products were resolved by electrophoresis in a 2% agarose slab gel. Visual inspection of the gel patterns indicated that markers at the two extremities of a mRNA gave the same pattern, indicating the capacity of this panel to link markers and make RH groups (Figures 3a-3c). Similarly, to test the quality of the oyster panel we selected six mRNAs from GenBank. However, in these cases the markers located at the two extremities of an oyster mRNAs gave different banding patterns (Figures 4a-4c and Table 4), suggesting that the DNA fragments in the oyster hybrid lines were short. To estimate the sizes of the fragments in the hybrid lines, we obtained oligonucleotides corresponding to sequence of BAC Ba127B8 located 500 nt apart. Markers 500 or 1000 nt apart had strictly or nearly identical distributions in the panel, as assessed by visual inspection, whereas markers 2000 nt apart had different distributions (Figures 5a-5d). These results indicate that the size of the DNA fragments retained by the hamster/oyster hybrid cells are shorter than 2000 nt and too short for the construction of an RH map of thousands of markers. However, we tested whether these RH lines could be used for the construction of maps of small (1 megabase or shorter) regions of interest in the genome. We obtained 40 pairs of oligonucleotides for amplification of a series of markers, 500 nt apart within a region of 20 KB of BAC Ba188K9 (Table 5) and genotyped with them the 94 hybrid cell lines of the RH oyster panel. The vector suites were determined and computed as usual [14,15]. Results of the two-point analysis are summarized in Table 6 and those of the multipoint analysis determining the order of markers, within the three largest groups are given in Table 7. Both analyses indicated that a dense regional map can be constructed.

aquaculture-research-development-agarose-electrophoresis

Figure 1: Agarose gel electrophoresis of PCR products obtained with various cell lines.
The left panel of Figure 1a corresponds to one sturgeon hybrid cell line and the right panel to another cell line. Similarly, Figure 1b corresponds to two oyster hybrid cell lines. Each slot corresponds to the products of PCR amplification of one marker.

aquaculture-research-development-histograms-retention

Figure 2: Histograms of the retention frequency of the sturgeon and oyster RH panels. Hybrid cell lines are numbered on the X axis. Presence/absence of markers was estimated by PCR analysis. Their retention frequency (percentage of markers in the clone) is presented on the Y axis (Figures 2a and 2b). The hybrid cell lines selected on quantitative and qualitative criteria to constitute the RH working panels are represented by a vertical black line. Hybrid cell lines not retained in the final working RH panel are indicated by grey vertical lines. In panels 2c and 2d are presented the retention values of the different markers used to check the hybrid cell lines.

  Mean Retention Values Panel Retention Values
  All clones Panel Min Max
Sturgeon 14% 25% 13% 50%
Oyster 22.7% 24% 3.1% 62.5%

Table 2: Marker retention values.
Retention values were calculated by genotyping 48 sturgeon and 32 oyster markers in each of the corresponding hybrid cell lines.

mRNA Length (bp) Oligonucleotide pairs at the 5’end Oligonucleotide pairs at the 3’ end
Forward Reverse Forward Reverse
EU241879 992 GGCAACCTGAAGAAGGCTCT gtgccttgtgtAACCgTCCT GCCTACATGGACCAACAAGC ATGTGAATCGGCTGTTTCCT
U65435 1091 gcagaagacctcgtgcagtt gtgaaattgcgcggaagag CCGCAGATGAAAGTTCAAGAG GCCTCCTGCCTATGTACCAG
HM348777 2343 ATGACCAgGGcAACAGGAC TGTGTTGGTGGGaTTCATtG CAGACTGCtGAGAaGGAGGA ATGGTaGGGCCGGAtgag
FJ428827 1684 ggatatctgaccccagagca acgtcaattgcaaggaaacc GATGACCTGTGGGTGGAGTT TCAGGTTCTCTGAGCCAAGC
AB111408 1634 acccctacggaccctatttt tccattagcagtttggcgta ACTTCCCTGTTTGACGAGGA TGATGAAATCGACAGGCAAA
AJ493258 1490 aggcaagaagaagagcaacg caatgcaagaaagagccatt AGGAAGTGAAAGCCAAAGCA TCCTCCCTGGTATTGACCAC
JQ288774 1205 ATTGCAGATCTCCAGCCTGT ATGTCCGTCATGCTGCTGT gaaggggtggactgtgaaga agcattcaatgTGGGGAAAC
JQ034508 2325 CGAGAGGAacCGcTATGAGA gAtCAGgGAgaccAcccAtA tgtccttgtgcttcttgctc cagcataccgcatttgcat
Y13253 1950 tcGACAagttCCTGGAAAgG cACgGCAGTGTCTTCAGTCT tcatgagaccatccaaccac acaggggttagccttgtcag
X90557 1027 tctcccaggagacacagtca TCTTCAGcCTGGACTCCACT tcccgctgcttgtaatgtc aagggtcaggcacattgaac
AB111407 3359 GGTGAGACaGCGGAGATGC CTGAAtCCGTTGCTGTGgAc CAGAGCTGGAGTGGGATTGT GCATAGCACTGAGCATCAACA
AJ493265 2145 CTgAATGACCGCTTtGtgAA cCTcTGgTTGGTgAggAtgT ATCCCATGTCACGGCTGTAG CACACACCTTGTTTGCTGATG

Table 3: List of sturgeon mRNAs selected for panel analysis.
Forward and reverse oligonucleotides were designed with software Primer 3 for the amplification of DNA fragments of roughly 100 nt.

aquaculture-research-development-distribution-sturgeon

Figure 3: Distribution of 5’ and 3’ ends of a sturgeon mRNA within the corresponding RH panel.
Agarose gel electrophoresis of pairs of markers located at the extremities of three different sturgeon mRNAs are displayed on figures 3a to 3c. For each mRNA, the left panel corresponds to the 5’end of the marker, and the right panels to the 3’end. On each sixth row, a sample of CHO DNA (negative control) was loaded into well 2 and a sample of esturgeon DNA (positive control) was loaded into well 4.

aquaculture-research-development-agarose-extremities

Figure 4: Agarose gel electrophoresis of pairs of markers located at the extremities of three oyster mRNAs.
The legend is as for Figure 3.

mRNA Length (bp) Oligonucleotide pairs at the 5’end Oligonucleotide pairs at the 3’ end
Forward Reverse Forward Reverse
AB118650 1228 CTTAGCGAGGGGGAGAGC CCAAAGTGCCTCCCAATTTA CCCCCACTGTGTGTGACC AAGAGAGAAATTCGGCCACAAG
JN251132 1855 CCTCCTCTCAGAACGCACA AGCTGATGGGTGGCAATTT AATCCAGTCTCAGGGCGTTT TCTCCACGTTGGACAGACTC
HM060303 2424 AGATGAGTGCGAGAGGTTCC CATCGGTCCCCGTCAGTT GGATGTACAACTCAAGCTTCAAC TGCTCCATGCGTTGTATTGT
HQ457439 2018 CGAAACGCGGGTTGTTATT TCTTCCATGTTTCTTTGCCTTT TGTTGTTTTGGTACATTGTGTATTAGA TTGAAATGATGTGTTTGCATTTT
AY713400 1128 ACATCCAGGCCGGTCAGT TCACCATGGTATGTGCCAGT TGATGTGCAGATGTTGAACG ACGTGGTGGGATGTCACAG
DQ336097 921 GTATAGCTGACCTGGGCCTTG TTTTCAGACCCGGAGCTACA GCTAATGACTAATGTCGAACTGG TTGGGGGCAAGTCTACCTC

Table 4: List of oyster mRNAs selected for panel analysis. Legend as for Table 3.

aquaculture-research-development-agarose-bac-markers

Figure 5: Agarose gel electrophoresis of four BAC markers.
Oligonucleotides were designed from the BAC Ba127B8 sequence for PCR amplification of markers separated by known distances. Figure 5a shows the distribution of marker “a” in the panel. Figure 5b shows the distribution of marker “b” which maps 500 nucleotides away from marker “a”. Figure 5c shows the distribution of marker “c” 500 nt away from “b” and figure 5d shows the distribution of marker ”d” 1000 nt away from “c”.

Marker names Left Primer Right Primer
Ma1 CACGCAACATTAAGCTTTGG GCGTCCCTGAACAGGTAATG
Ma2 TGCGTTCTGTACGTGAACCT CGCCGCTCATAGGTAGAAAC
Ma3 CGAGGGCACGAATAGACTGT GGGACTTGTGGTCTGCTGTT
Ma4 TCGGAATAACGTGACTCGAT AGTAGGATTCGCCTGATTGC
Ma5 AGGCTCGATTTGCATCATTT AAACATGTCCCCTCGTGTTC
Ma6 GTTCCCATGAGGAGGGATTT TGTCGGCTAGTGTGGAACAG
Ma7 GCTTCTTCACCTTCGCACTC CGACTGGTGAGATGCTTCAA
Ma8 GTGGGTGCATCATTTCACAG CGGCTTATGGAAGGTGATGT
Ma9 TTGTACGTGTGGGGGAAAGT TGCTTTCGGATCTCCTCAGT
Ma10 AATCCAAGATGGCGAGTGTC GGTCAATTCGGCATGTTTTC
Ma11 CAGGAGACGATTTGGCTGTT GCGACATTGCAGGAAAATTA
Ma12 CGGGTGCACTTTCACTGATT ACATGGTTTTCAGCCTGGAC
Ma13 GATGTCCGTGAAAGTGACTCC AAAAATCAGGTTTAGTTCGACAGG
Ma14 CTGTTGGCCTTACATGTTGTG ACAGGGATTGGACACAAGTTC
Ma15 CCGGCGATATGACAGAGTAGA CGCCTAGGGTGTGACATTTT
Ma16 ATTGCCCGCTGTTTCACT GCGTTTTTCCAATTTTTCCA
Ma17 ATCAGAGACTGGCCCATGTT GCCTGATGGTGGTGATCATA
Ma18 GAATCATGGACAGGGACTGG CTCAAAACCATCCCCTACGA
Ma19 TCTTCCTCCGTACCCATTCA TTTAGTCAAGTGAGATGTTGTTTGC
Ma20 TTGCCTAGCGACATCTCACC CGGCTGCATACTCTTCATTG
Ma21 GTGCGCCATGAAAAGGATAC GATCCGCAAAAAGCTGAAAC
Ma22 TTGCATACAAGGTGGTGAGC GAAAATCAACCCTGAACCAAGA
Ma23 CCCTACCAGACAGGACAATCA CAAACCACTGCCAATCACTT
Ma24 TCACAGGCAAAGACACTGGT TCCACTTTTGATCTGCTGTTAGG
Ma25 CAAGCCAGTCCACACTCTTCT ATTGCCTGGACATTGGTGAT
Ma26 TCCACCATGGCAGTCTAAAG TGCACTGTGTCTTTCCTTTCTG
Ma27 GGAATCCCATGAAACATCAGA AGCCCTCCTACAGCTCCTTT
Ma28 TCGTGCCACACTGAGAGACT TTCCAGGGAGACAGTGCTTT
Ma29 GTACAATACGCACCCCCAAC TCAGGATTACCGTTTGGTCA
Ma30 AAAAACGGACGGTGTACAGG ATTTTATTATGTTCCAGGCCTCT
Ma31 TGTCAAAGCTCACCTCCCTTA CCAGTACCGGGTATTTGCAT
Ma32 CACCACCGGGTTAGAGAAGA TCTGACAGCTTTCTCCGGTA
Ma33 AATGCACAGCCAAATGTAAAC CCAAGTTTTCTACTGTGCAATCA
Ma34 AGACTCCTGCAGCCCTGAC TTCACTGTGCGACCTTTGAC
Ma35 AGGTCATCTCTGAGGGTCAAG TTCCTCAGGTGATGCTGACA
Ma36 CCTGGTAAAATTCTATGCCACA ACCTCCTTTACAAGCATCCAG
Ma37 CCAGAGTTGTTTCCCCTGTC CAGTGTTCACCACCCAAAAG
Ma38 TTGAGCAGTTATTCAGTGCTTATTG CGGGGGTATTAGTCCCATTA
Ma39 AGCCAAGCAATGCTCTTCTG AGGAGAAAGTGAGGAAAATTTGAA
Ma40 TCAGATAATGGCTCCCTTGG GCAACGTTTTTGTTTGTCAATG

Table 5: List of oyster markers designed on BAC Ba188K9.
Forty sequences regularly spaced over 20 Kb were selected. Forward and reverse oligonucleotides were designed with Primer 3 to amplify short DNA fragments as markers named : Ma1 to Ma 40.

# of Markers /linkage groups 7 6 6 2 2 7 unlinked Markers 10 non genotyped Markers
Marker names Ma34
Ma33
Ma32
Ma27
Ma26
Ma25
Ma23
Ma8
Ma6
Ma3
Ma1
Ma2
Ma5
Ma15
Ma19
Ma20
Ma21
Ma17
Ma18
Ma31
Ma28
Ma29
Ma30
Ma4
Ma7
Ma10
Ma11
Ma16
Ma36
Ma37
Ma9
Ma13
Ma14
Ma15
Ma22
Ma24
Ma35
Ma38
Ma39
Ma40

Table 6: Results of the two-point analysis performed on BAC 188K9.
Five RH linkage groups were obtained with Multimap software at a lod score of 3.0. (Matise et al. 1994). As indicated in the legend to Table 3, markers were named according to their positions on the BAC sequence. Note that RH groups are constituted of markers located close together on the BAC sequence.

RH group 1:
Marker names Relative position in the RH group Distance between markers Cumulative distance Theta (%) 2pt LOD
Ma 23 1 0.0 cR      
Ma 25 2 69.4 69.4 cR 50.0 % 3.2
Ma 26 3 15.0 84.4 cR 13.9% 10.8
Ma 27 4 9.9  94.3 cR 9.4 % 11.8
Ma 32 5 28,9 123.2 cR  25.1 % 6.9
Ma 33 6 35,2 158.4 cR 29.6 % 6.3
Ma 34 7 21,2 179.6 cR 19.1 % 9.0
RH group 2:
Marker names Relative position in the RH group Distance between markers Cumulative distance Theta (%) 2pt LOD
Ma 8 1 0.0 cR      
Ma 6 2 68.2 cR 68.2 cR 49.4 % 1.3
Ma 3 3 16.8 cR 85.1 cR 15.5 % 5.0
Ma 1 4 16.9 cR 102.0 cR 15.5 % 7.1
Ma 2 5 48.4 cR 150.4 cR 38.4 % 5.5
Ma 5 6 55.5 cR 205.8 cR 42.6 % 4.3
3rd group:
Marker names Relative position in the RH group Distance between markers Cumulative distance Theta (%) 2pt LOD
Ma15 1 0.0 cR      
Ma19 2 24.8 cR 24.8 cR 22.0 % 6.4
Ma 20 3 53.7 cR 78.5 cR 41.6 % 4.7
Ma21 4 61.4 cR 139.9 cR 45.9 % 3.0
Ma17 5 37.1 cR 177.0 cR 31.0 % 3.8
Ma18 6 53.3 cR 230.3 cR 41.3 % 3.8

Table 7: Order of markers within the three largest RH groups.
Multipoint analyses were carried out with CarthaGene software. Distances are expressed in centirays (cR3500) (Schiex et al. 1997). The order of markers as defined by the sequence nucleotide (1st column) appear to be exactly the same as that defined by RH mapping (2nd< column) for RH group 1. In RH group 2 and 3, there are a small number of inversions between the two methods but overall the two mapping strategies gave collinear results all along the 20 Kb of BAC188K9 analyzed.

Discussion

With the advent of the high throughput sequencing technologies, collectively named NGS (next generation sequencing), and the substantial reduction in the associated costs, it could be believed that the construction of physical maps of genomes is no longer required. Indeed, genome sequencing strategies have progressed from sequencing BAC clones organized into a physical map [16], to a global shotgun strategy as was used for the human genome sequence [17,18] and then the canine genome sequence [19]. However, despite the development of very sophisticated algorithms to assemble NGS reads, the recent releases from whole genome sequencing projects based on a NGS approach showed highly discontinuous sequences composed of hundreds of thousands contigs) [20]. This is due to the reads being short (relative to the entire genome) and an uneven coverage of the whole genome. To overcome this problem of discontinuity, genome maps constructed with a large number of markers were, and still are, a necessity [21-23].

RH maps are by definition not physical maps, as distances between markers are measured in centirads, which result from a statistical treatment of the data. Nevertheless, they are valuable, partly because they are straightforward to construct due to the development of high throughput genotyping methods; also, diverse markers, both polymorphic and non polymorphic, with a large range of marker density, can be used as long as the level of radiation applied to the donor cell before fusion is appropriate [24].

There are, nevertheless, various difficulties associated with the construction of RH panels: some are associated with particular steps of the construction, and some differ between projects. Constructing panels for mammal species does not present any particular difficulty, because donor cells are easy to obtain and their fusion with rodent cells poses no problem.

By contrast, the construction of RH fish panels was long considered to be difficult, or even impossible, mainly because of the absence of a suitable source of donor cells. The strategy we developed using the spleen as the starting material proved to be very effective [7,8]. Splenocytes can be obtained in very large numbers, ready to use after cutting the whole organ into pieces with scissors and gentle dissociation in a Potter device. Fusion between fish splenocytes and hamster cells was straightforward: we have been able to produce hybrid cells with all the species we have tested so far, including seabream [6], seabass [7], tilapia [8], sturgeon (this work) and trout (unpublished data). For oyster RH lines, once we had overcome the technical issue of the difference in the osmotic pressures appropriate for oyster cells and the hamster cells, we had no major difficulty in obtaining enough donor cells from oyster muscle.

The main problem in any RH panel construction is the uncertainty about whether the TK or HPRT proteins of the donor cells are expressed and active in the hamster environment, so as to allow the growth of the hybrid cell lines and prevent the growth of the receptor cells. Unfortunately, this is highly unpredictable. For all the fish panels we have constructed, the donor HPRT gene was used to select the hybrid cells, and for some of them the TK gene could also have been used. In an attempt to make a RH panel for crocodile (Crocodylus porosus), we prepared fresh white blood cells from 50 ml of blood. These cells were then irradiated and fused with acceptor hamster cells. The number of hybrid clones was the same whether the HPRT of TK gene was used for selection (unpublished data). Conversely, neither the TK nor the HPRT proteins in the oyster were able to allow strong growth of the hybrid cells, or their selection from the non-fused hamster acceptor cells. Nevertheless, oyster markers were detected in the DNA extracts demonstrating that there had indeed been cell fusion, and the oyster TK and HPRT proteins allowed the hybrid cells to survive under HAT selection (Figure 1b). Selection of the hybrid cells is an essential step in the construction of any panel, but currently, only the TK and HPRT genes can be used for this purpose. To overcome this limitation, we attempted to transform the oyster muscle cells, prior to fusion, with a plasmid (Addgene plasmid 20652) carrying the human TK gene, which, intrinsically, is able to complement the CHO deficiency. Although transformants were obtained, their numbers were too low to produce a RH panel.

As demonstrated by the typing of 40 markers of BAC Ba188K9 and the corresponding mini RH map, the oyster RH panel we produced could nevertheless be useful to make very dense RH maps of small regions of particular biological interest. Whole genome sequencing with NGS technologies provides very short contigs, many in the range of one to two kb. These contigs are usually assembled in scaffolds made of several contigs. But checking the exactness of some scaffolds of particular biological interest could be important and would be feasible with such oyster panel

In this study we demonstrate that the construction of RH panel for a wide variety of species is entirely feasible starting from various tissues as spleen, blood or muscle as sources for the donor cells. We also show that the issue of the ability of donor TK or HPRT proteins to rescue the hybrid cells remains problematic. Consequently, the development of alternative systems for selection would be very useful, given the importance of RH maps as resources for aquaculture, and more generally their utility in whole genome sequence assembly

Acknowledgements

This work was supported in part by ANR (Agence Nationale de la Recherche, France-Gametogenes project (08-GENM-041-03).

Conflicts of Interest

Authors declare no conflict of interest.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 11653
  • [From(publication date):
    June-2013 - Nov 25, 2017]
  • Breakdown by view type
  • HTML page views : 7894
  • PDF downloads : 3759
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords