alexa Involvement of PRCD and RPGR Genes in Progressive Retinal Atrophy in Locally Bred Canines | OMICS International
ISSN-2155-9929
Journal of Molecular Biomarkers & Diagnosis

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Involvement of PRCD and RPGR Genes in Progressive Retinal Atrophy in Locally Bred Canines

Ushma Dave1* and Dave CJ2

1Department of Biotechnology, M B Patel Science College, Anand, 388001, India

2Department of Biotechnology, Veterinary Science College, Anand, 388001, India

*Corresponding Author:
Ushma Dave
Jain University, Nabobiosciences
Bangalore, Karnataka 562112, India
Tel: +91 8971209696
E-mail: [email protected]

Received Date: December 05, 2013; Accepted Date: Januauary 15, 2014; Published Date: Januauary 21, 2014

Citation: Dave U, Dave CJ (2014) Involvement of PRCD and RPGR Genes in Progressive Retinal Atrophy in Locally Bred Canines. J Mol Biomark Diagn 5:161. doi:10.4172/2155-9929.1000161

Copyright: © 2014 Dave U, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Molecular Biomarkers & Diagnosis

Abstract

Progressive Retinal Atrophy is a group of genetically inherited diseases in various canine breeds. The disease begins with retinal damage and progresses to blindness. Abnormalities in various genes are linked with different disease variants, and in most cases, involvement of one gene towards PRA is specific to one breed. However, Progressive Rod Cone Degeneration (PRCD) is an outlier. PRCD anomaly is associated with PRA in more than 20 breeds. The same gene mutation which causes PRA-prcd in dogs causes a form of Retinitis Pigmentosa in human. X-Linked Progressive Retinal Atrophy (XLPRA); a type of PRA, is a result of deletion in Retinitis Pigmentosa GTPase Regulator (RPGR). RPGR is a locus homologue of human Retinitis pigmentosa (RP3). We analyzed 22 clinically PRA positive dog samples for PRCD and RPGR association with PRA. We employed PCR-RFLP, capillary gel electrophoresis and sequencing. Experiment data suggests that tested mutation of PRCD has no association with PRA in all 15 Pomeranian and 1 Mongrel dogs which are locally bred by Indian breeders. In contrary, all English Cocker spaniel and Labrador Retriever samples showed PRCD association with PRA. Furthermore, accountability of tested mutations in RPGR has been concluded to be nil in all of the test samples.

Keywords

Progressive retinal atrophy; XLPRA; PRCD; RPGR; Retinitis pigmentosa

Introduction

Progressive Retinal Atrophy (PRA) is a group of genetic diseases found in 100 plus canine breeds [1]. The typical characteristic of the disease is loss of night vision followed by gradual loss of peripheral vision leading to total blindness [1]. The disease causes great deal of discomfort in the breeding industry as well as to the owners as the disease is incurable. In addition, canine PRA has potential to serve as an animal model in human Retinitis Pigmentosa (RP) [2]. This is due to shared molecular defects and/or phenotypic similarities [3]. Thus, in the field of Veterinary science, it is critical to understand, avoid and eradicate PRA. Strong association of PRA with human RP promises to answer essential questions on the disease.

Complete ophthalmic diagnosis can identify later phase of the disease. However, earlier stages are not detected by this method. While Electroretinogram (ERG) can diagnose disease at early stages [4], it requires technological advances and expertise. In addition, animal needs to undergo anesthesia, which is a risky affair. Due these added complications, ERG is not the most preferred method for diagnosis of PRA.

In the canine care industry and the breeding industry in particular, it is critical that genetic diseases are diagnosed at the earliest to exclude affected and carrier dogs from breeding program. Such strategies can facilitate eradication of diseases. Molecular biology based diagnosis is a cost effective strategy in the current scenario.

The disease is found to be inherited in variety of transmission method engaging multiple genes and mutations [5]. The relations between particular disease causing gene anomalies and breed have been established. In most cases, one gene is associated to one flavor of disease in one breed [2]. However, as an exception, PRCD is reported to be linked to more than 20 breeds [6].

PRCD is located on CFA9 [7]. Mutation in PRCD can give rise to PRA-prcd. This happens when amino acid Cysteine is replaced by Tyrosin as a result of homozygous mutation TCG, TAC at nucleotide 5 of coding sequence [6]. In PRA-prcd, late onset degeneration starts from rod cells which progresses to con cells [8]. The inheritance pattern of the disease is autosomal recessive type. This is why it is important to test all dogs involved in breeding program, regardless their phenotype.

Deletion in gene Retinitis Pigmentosa GTPase Regulator (RPGR) can give rise to X-Linked variant of PRA in some breeds [9]. In exon ORF15 on X-chromosome, deletion of 2bp and 5bp in RPGR gene can lead to XLPRA1 and XLPRA2 correspondingly [5]. The five nucleotide deletion in XLPRA1 results in frame-shift, which leads to immediate premature stop codon. This is only true for Siberian husky and Samoyed yet. In Mongrel, two nucleotides deletion results in frame-shift. This further leads to significant changes in deduced peptide sequence [9] and disease phenotype. XLPRA1 is an early onset disease while XLPRA2 occurs at later age. The gene is canine homologue of Retinitis Pigmentosa [4]. Further, study reports that RPGR is associated with impaired hearing and sinorespiratory infections, in addition to retinitis pigmentosa [10]. Added complications and link to human disease make this gene a good study candidate. As per Guyon et al. [11], dog is the only naturally occurring model of RPGR-XLPR.

In Pomeranian, relation of PRCD or RPGR to PRA is not yet established. In one effort [5] to ascertain RPGR to PRA relation, they found no such link for tested Pomeranian. In addition, their Pomeranian sample size was limited to 2.

We aim to identify if there is an association with PRCD and/or RPGR gene mutation and PRA in sampled breeds.

Materials and Methods

Clinical investigation/ophthalmologic examination

22 dogs-15 Pomeranian, 3 Cocker spaniel, 3 Labrador Retriever and 1 Mongrel with history of vision loss were examined. Examination included various visual function tests such as menace response, papillary light response and tapetal response. Then the dogs were subjected to indirect ophthalmoscopy for fundus examination after dilation of pupil with mydriatics. If fundus examination revealed pale optic disc, the animal was considered clinically positive for PRA.

DNA extraction from blood

Blood samples from 22 PRA positive dogs (aged 2-15; mean age 8.7) were collected in LABTUBE (Lebtech disposables, India) containing EDTA. Blood DNA extraction was carried out following John (1991).

Mutation analysis for PRCD gene by PCR-RFLP

The exon1 of CFA9 was subjected to PCR amplification using sequence specific primers. These primers were selected from a reference article [3], primer sequence for forward primer was 5’CCAGTGGCAGCAGGAACC3’, 5’CCGACCTGCTGCCCACGACTG3’ for the reverse primer. PCR was carried out under the conditions of 95°C for 5 min and then 37 cycles of 95°C for 45 sec, 58°C for 35 sec, 72°C for 35 sec and 72°C for 5 min with the specific primer pairs as above. 512 bp PCR amplicons were digested by restriction enzymes RsaI and Alw441. Digestion with RsaI resulted in 396 bp and 116 bp fragments in mutated allele while digestion with Alw441 produced products of 397 bp and 115 bp in normal allele. Products were checked on 2% agarose gel.

Analysis for RPGR deletion causing XLPRA by fragment analysis

The ORF15 sequence was amplified by PCR using HEX fluorescence labeled specific primers. These primers were selected from a reference article [3] for mutation analysis; for XLPRA1, 5’AAGGGGAGGAGAAAGGGGAGGCT3’ and 5’TCCCTCTTCCTCCTCCCCTTCATA3’ were used as forward and reverse primers respectively. For XLPRA2, forward and reverse primers sequences were 5’AAGGGGAGGAGAAAGGGGAGGCT3’ and 5’TCCCCTACTTCCTCTTCCCTCTCA3’ correspondingly. PCR was carried out under the conditions of 98°C for 10 sec and then 30 cycles of 98°C for 2 sec, 57°C for 30 sec, 72°C for 15 sec and 72°C for 1 min with the primer pairs listed above. Then deletion was detected by fragment size analysis using ABI PRISM 310 Genetic Analyzer.

Results and Discussion

Our data shows that of all PRCD amplified from PRA positive samples are of same size as normal/control. We did not observe any indels. Restriction fragment length polymorphism study demonstrated that all samples, excluding 3 Cocker spaniel and 3 Labrador Retriever, lacked point mutation at the interest site. Point mutation at the site should facilitate RsaI digestion. Furthermore, these RsaI undigested DNA fragments presented Alw441 restriction site as normal, Figure 1(A). This confirms presence of nucleotide ‘G’ at 5bp position, like unaffected.

molecular-biomarkers-diagnosis-Representative-Restriction

Figure 1: Representative Restriction Digest test of PRCD gene; (A) PRCD positive sample. DNA ladder (2 μl). Digested, undigested and control sample (10 μl). (B) PRCD negative sample. Digested, undigested and control sample (10 μl).

Moreover, our study on Cocker Spaniel and Labrador Retriever: breeds with known association of PRA and PRCD confirmed presence of RsaI and lack of Alw441 restriction site in PRCD, Figure 1(B). Our results are in accordance with previous studies by [5]. These PRCD positive samples were of average age 7.33 (8, 7, 7) years for Cocker Spaniel and 5.33 (6, 5, 5) years for Labrador Retriever. This fits with normal late onset scenario for PRA-prcd. From the data, we can suggest that 3 Cocker spaniels and 3 Labrador Retriever were PRA positive: PRA-prcd variant.

PRCD is believed to be an important protein coding gene. Even though, this point mutation does not alter secondary structure of the coded protein, it must be affecting recognition site provided by this protein [3]. Moreover, high level of conservation of this protein in all vertebrates suggest, that the protein must play an important role in metabolism or photoreceptor structure exclusive to vertebrates [3]. Thus, abnormalities to this gene can lead to visual imperfection.

As an additional study, these dogs were accessed for X-Linked PRA. We accessed the samples for two known XLPRA; XLPRA1 and XLPRA2. Agarose gel electrophoresis and capillary electrophoresis results revealed that all 22 PRA positive samples are free from XLPRA1 & XLPRA2 (Figures 2 and 3). This is because we did not observe any size variation in the product, when compared to reported size. In these circumstances, it is very tempting to conclude that none of PRA positive dogs has XLPRA. Nevertheless, most recent study has suggested that there has to be a third kind of X-Linked PRA (XLPRA3), especially in Border collie [5], but exact mutation is still unknown. Besides, the gene is also found with neutral mutation in Red wolves; a member of canine family [3]. Therefore, it can be suggested that study samples do not have XLPRA1 or XLPRA2, but it cannot be confirmed whether they have X-Linked PRA or not.

molecular-biomarkers-diagnosis-electrophoresis

Figure 2: Representative electrophoresis gel of RPGR PCR for (A) XLPRA1 detection (257/252 bp). Well 1-12 are Loaded with amplified RPGR of sample PR-1 to 12 (5 μl). MM: GeneRulerTM 50 bp DNA ladder, 50-1000 bp (Fermentas) (2 μl). (B) XLPRA2 detection (523/521 bp). Well 1-6 are loaded with Pomeranian (well 1-2), Labrador retriever (well 3-4) and Cocker spaniel (well 5-6) (5 μl each). MM: MassRuler™ Low Range DNA Ladder, 80-1031 bp (Fermentas) (2 μl).

molecular-biomarkers-diagnosis-fragment-analysis

Figure 3: Capillary gel electrophoresis, fragment analysis of XLPRA1 by 310 ABI-PRISM. Peak of 744 FU intensity at 256.93 (257 bp).

Sequencing of PCR products and linkage analysis can ascertain XLPRA positive or negative status for the samples studied. This suggested further work should also support our finding on PRA-prcd [12-16].

Conclusion

From our data, we propose that in all tested Pomeranian and Mongrel PRCD mutation is not linked to PRA. Larger sample size could firmly allow exclusion of Pomeranian from future PRCD tests. In spite, we suggest further work of sequencing the gene to identify any other undetected anomalies contributing to the disease. Additionally, in agreement to previous study on Cocker Spaniel and Labrador Retriever, we find mutation in PRCD of PRA positive dogs.

We also elucidate that all tested dogs are free from XLPRA1 and XLPRA2.

Only good if you get XLPRA positive. Rpgr

It was proposed that the purine-rich region may adopt unusual non B-DNA conformations and show sequence motifs similar to DNA polymerase-a arrest sites found near other deletion hotspots; this can lead to micro deletions following slipped-strand mispairing events. We have found similar micro deletions in the present study, suggesting that RPGR exon ORF15 appears to be a mutation hotspot in canids. Our studies demonstrate that the nature of the RPGR exon ORF15 deletions determine the retinal phenotype. Both disorders are distinct, and have remained so even though the diseases now are present in mixed-breed dogs of the same genetic background.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11828
  • [From(publication date):
    January-2014 - Jul 19, 2018]
  • Breakdown by view type
  • HTML page views : 8038
  • PDF downloads : 3790
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7