alexa Isolation and Characterization of Polymorphic Microsatellite Loci in the Redclaw Crayfish, Cherax Quadricarinatus | OMICS International
ISSN: 2155-9546
Journal of Aquaculture Research & Development
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Isolation and Characterization of Polymorphic Microsatellite Loci in the Redclaw Crayfish, Cherax Quadricarinatus

Lin He1, Jing Xie1, Qing Li1, Yunlong Zhao1, Yaping Wang2 and Qun Wang1*

1School of Life Science, East China Normal University, Shanghai 200062, China

2Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China

*Corresponding Author:
Qun Wang
School of Life Science
East China Normal University
Shanghai 200062, China
Tel: +86 21 24206614
E-mail: [email protected]

Received Date: September 20, 2012; Accepted Date: November 23, 2012; Published Date: November 30, 2012

Citation: He L, Xie J, Li Q, Zhao Y, Wang Y, et al. (2013) Isolation and Characterization of Polymorphic Microsatellite Loci in the Redclaw Crayfish, Cherax Quadricarinatus. J Aquac Res Development 4:162. doi:10.4172/2155-9546.1000162

Copyright: © 2013 He L, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Aquaculture Research & Development

Abstract

Here we developed and optimized 15 polymorphic microsatellites isolated from Cherax quadricarinatus enriched for CA repeats. We tested variability of these microsatellites in 60 unrelated individuals cultured in China. All microsatellite loci were polymorphic. Number of alleles per locus ranged from 2-7 while observed and expected heterozygosities ranged from 0.2549 to 0.8615 and from 0.3405 to 0.8174, respectively. Fourteen of the 15 microsatellites conformed to Hardy–Weinberg Equilibrium. These microsatellite loci developed here provide an important resource for studying genetic diversity and population structure in redclaw crayfish and potentially in other related species.

Keywords

Aquaculture; Microsatellites; Red claw crayfish; Polymorphism

Introduction

The redclaw crayfish Cherax quadricarinatus accounts for the entire commercial production of freshwater crayfish in Australia [1]. Its culture potential has also been recognized in other countries, including the USA and China, and this species was introduced to China in the early 1990s for commercial culture. Genetic markers can characterize relative levels of population variation and differentiation in both wild and cultured stocks [2]. Knowledge of populations is limited for cultured stocks in China and it is unlikely that much of the natural variation that exists across the large natural range of this species has been exploited in culture. So our work on SSR markers isolation and studies of genetic diversity and population structure will provide important information for promoting development of aquaculture of C. quadricarinatus in China.

Microsatellites are simple DNA sequences, repeated in tandems that are widely dispersed across the genomes of eukaryotic and prokaryotic organisms. Most loci are highly variable and considered to be selectively neutral, making them amenable to population genetic analysis [3]. Until now, only a limited number of microsatellite loci have been developed for C. quadricarinatus [4]. Thus, isolation of more microsatellite loci from C. quadricarinatus will be important for elucidating population structure and for monitoring relative levels of genetic diversity in sampled populations.

Materials and Methods

Sampling and DNA isolation

The cultured C. quadricarinatus individual samples were collected from Xia Men in China. Total genomic DNA was extracted from muscle tissues using the standard proteinase K–phenol–chloroform method [5].

The isolation of microsatellite loci

Microsatellites were isolated using a magnetic beads enrichment procedure with modifications [6]. Two genomic DNA samples from male and female individuals were first pooled. About 10 μg of DNA was then digested with Mse I and purified with Wizard PCR Purification kit (Promega and ligated to the adaptors (ADP1: 5’-AGATGGAATTCGTACACTCGT-3’ and antisense strand ADP2: 5’-TAACGAGTGTACGAATTCCATCT-3’). Magnetic beads captured DNA containing microsatellites were eluted in 30 μL water. DNA enriched with microsatellites was amplified in a 25 μL reaction using the ADP1 as primer to know the successful ligation [7]. PCR products of 25 μL were electrophoresed on 1% agarose gel, fragments between 400- 1000bp were cut from the gel and purified by Wizard PCR Purification kit (Promega). About 50ng concentrated DNA was directly ligated to 25 ng pGEM-T vector (Promega) according to the manufacturer’s protocol. The ligation products were transformed into Escherichia coli TOP 10 competent cells (Tiangen) and plated upon LB-agar containing 50 mg/L ampicilin, 60 mg/L IPTG, and 40 mg/L X-gal. A partial genomic DNA library enriched for CA- microsatellites was established. White clonies were picked into 96-well Deep Well Plates and cultured at 37° with shaking for 4h. A PCR-based method was used to screen recombinant clones using M13 and (CA)10 as primers. We only select the clones that have two or more amplified bands in the PCR products, which ensure these clones contain CA or GT repeats fragment [8]. 45 selected clones with repeat elements were sequenced with M13 universal primer (Invitrogen), of which 30 unique sequences were chosen for primer design using PRIMER PREMIER 5.0 (PREMIER Biosoft International).

Detection of polymorphic microsatellite loci

To characterize the isolated microsatellites, we obtained 60 cultured redclaw crayfish individuals from Xia Men in Fu Jian province. Total genomic DNA was then extracted from these individuals as templates. PCR were performed in 25 μL reactions each containing: 20 ng DNA, 0.5 U Taq Polymerase (TaKaRa), 1× PCR reaction buffer (Mg2+, 0.2 mM of each primer, 0.2 mM of each dNTP and ddH2O in a final volume of 25 μL. PCR conditions were as follows: 94°C for 3min followed by 35 cycles of 94°C for 30 s, annealing temperature for 30 s and 72°C for 30 s with a final extension for 10 min at 72°C. Amplified products were separated on QIAxcel DNA High Resolution Cartridge (QIAGEN, Shenzhen, China) using the QIAxcel System (QIAGEN, Germany) and the resulting data were analysed with BioCalculator software [9]. The QIAxcel provides an automated system that increases sample throughput, reducing labour costs and decreasing sample processing time [10].

Results and Discussion

We screened 72 recombinant clones with M13 and (CA)10 primers, 45 selected clones with repeat elements were sequenced with M13 universal primers (Invitrogen). We designed and tested a total of 30 primer pairs, 12 of them failed to amplify or showed complex amplification, three were monomorphic and 15 were polymorphic in the population screened here. The number of alleles, observed and expected heterozygosities were analyzed by Popgen32 [11]. The number of alleles per polymorphic loci varied from 2 to 7 and the values of observed heterozygosity and expected heterozygosity ranged from 0.2549 to 0.8615 and from 0.3405 to 0.8174, respectively (showed in table 1).

Locus name Repeat motif Primer pair sequence (5’-3’) Tm (°C) Size range No of alleles HO HE HEW
P-value
PIC GenBank
Accession no.
CQ1 (GT)16 F:ACCTGTCGCACTCTGTATCAA
R:ACCTAGTAGCGATCAATGAAGAG
56.4 273-293 3 0.6897 0.6439 0.6878 0.5617 HM035026
CQ2 (CA)42 F:TCACCAGGCTTTGAAATAGT
R:CATTTGCCGTCTTCCATACC
56.4 180-240 7 0.8167 0.8174 0.2154 0.7850 HM035027
CQ3 (GT)24 F:ACTTCTCTGTGTATATATCCTGTG
R:CAGACACCAAACACCAAGAT
56.4 154-193 3 0.3103 0.3405 0.1834 0.3121 HM035028
CQ4 (TG)13 F:TAGCACCAGAGAGAGTCAGG
R:TGGAGCAGGAAAAGTGAG
56.4 183-200 3 0.5000 0.5118 0.4754 0.3868 HM035029
CQ5 (AC)15 F:TAGTAGCGACCAGTGAAGAG
R:GCGTTGTTTTGACACAGAAG
56.4 187-237 4 0.5714 0.6173 0.0817 0.5322 HM035030
CQ6 (CA)23 F:CTAGTCGCTACCAGCAAAGA
R:CAACCTCCTGGGACTTACTG
50.4 408-418 2 0.6032 0.4246 1.0000 0.3325 HM035031
CQ7 (TG)22 F:TGTCTTCAACTTCCAACTGTG
R:ATAAATGTGAGAGCCCAGGT
50.4 175-246 3 0.7600 0.6305 0.9729 0.5478 HM035032
CQ8 (TG)14 F:TCCCTGTGATTCATCTGTTT
R:GTAGCGATCAGTGAAGAGGC
63.9 382-405 2 0.8000 0.4837 1.0000 0.3648 HM035033
CQ9 (TG)13 F:CTCCACTATTCTGTTTGCTTTG
R:GTAGCAATAAGCGAAGAGGC
62.7 171-175 2 0.4688 0.3780 0.9944 0.3047 HM035034
CQ10 (CA)18 F:ACACACACGCACAAGGGTAGAC
R:CCGATTTCCCTCAACCTTTC
62.7 261-289 4 0.8615 0.6730 0.9998 0.6101 HM035035
CQ11 (TG)11 F:CCATTGTACCTCCCTTTTTT
R:CAGCCACAGTAGCAGTCAGT
50.4 332-365 2 0.2549 0.3931 0.0171* 0.3135 HM035036
CQ12 (AC)40 F:GTTCAGGGAGAGTGACCTAGTAGC
R:CCTCCTCGGTTGTTATGTTATT
50.4 389-403 2 0.6000 0.4923 0.9533 0.3675 HM035037
CQ13 (GT)37 F:TGTGACCCCTTGTTTCTGTG
R:GCCCGTCATTCAAGCCAAAG
63.9 239-258 3 0.3810 0.5116 0.0978 0.4551 HM035038
CQ14 (TG)29 F:TTTCCTCAGCCTTATCACCT
R:GGTAATGAACTCTGGGTAGGTC
55.0 330-363 3 0.8537 0.5285 1.0000 0.4188 HM035039
CQ15 (TG)26 F:ATACTCCCTCTTGGTGTTCC
R:GTAGCGGTCAGTGAAGAGGC
63.9 380-403 2 0.7846 0.4805 1.0000 0.3631 HM035040
Average         3 0.6171 0.5284 0.6453 0.4437  

Table 1: Microsatellite isolated from Redclaw Crayfish (Cherax quadricarinatus).

P value for Hardy–Weinberg equilibrium (HWE) estimates and linkage disequilibria were estimated by using Genepop [12]. Except locus CQ11, fourteen loci conformed to Hardy–Weinberg Equilibrium in the population (P>0.05). Observed deviations from HWE expectations may result from sampling effects, presence of null alleles or excessive heterozygosity. Linkage disequilibria (LD) was detected between CQ3 × CQ14, CQ3 × CQ10, CQ3 × CQ9, CQ7× CQ9, CQ7 × CQ13, CQ8 × CQ15 (P<0.05) and indicate that these loci may be physically linked on individual chromosomes in redclaw. We suggest that potential linked loci identified here should be used with caution, and perhaps only one from each set should be used in order to avoid pseudo-replication in population genetic analyses.

Polymorphism information content (PIC) is recognized as a measure of the relative utility of molecular markers [13] and comparisons of PIC values can provide an estimate of the relative power of individual markers [14]. Per-locus PIC values here ranged from 0.3047 (CQ9) to 0.7850 (CQ2) respectively, with a mean of 0.4437. Five of the 13 polymorphic loci identified were shown to be highly informative (PIC>0.5). The remaining ten loci were moderately informative (0.25<PIC<0.5), and none was only slightly informative (PIC<0.25). This indicates that the set of microsatellites developed here show considerable potential for analyzing genetic polymorphisms in red claw populations.

All the results are shown in table 1. Until recently, there are only a few DNA markers available for the red claw crayfish. Therefore, these 15 novel microsatellite markers could facilitate studies on genetic diversity and population structure of the red claw crayfish to supply useful information for conservation of cultured stocks, and even potentially used in the study of other related freshwater crayfish species.

Acknowledgements

This study was supported by grants from Science and Technology Commission of Shanghai Municipality (08JC1408300 and 08DZ1906401) and collaborated with the State Key Laboratory of Freshwater Ecology and Biotechnology (2010FB13) in Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan. We would like to thank Shuai Zhan and PanYu Hua for their help with software.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 11585
  • [From(publication date):
    January-2013 - Dec 17, 2017]
  • Breakdown by view type
  • HTML page views : 7818
  • PDF downloads : 3767
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

biochem[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version