alexa Loop-Mediated Isothermal Amplification Assay Targeting the 47-Kda Gene of Orientia tsutsugamushi: A Rapid and Sensitive Alternative to Real-Time PCR | Open Access Journals
ISSN: 2161-0703
Journal of Medical Microbiology & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Loop-Mediated Isothermal Amplification Assay Targeting the 47-Kda Gene of Orientia tsutsugamushi: A Rapid and Sensitive Alternative to Real-Time PCR

Erin Huber1,2, Darder Ji3, Lee Howell1,2, Zhiwen Zhang1,2, Hua-Wei Chen1,2, Wei-Mei Ching1,2 and Chien-Chung Chao1,2,*

1Viral and Rickettsial Diseases Department, Infectious Diseases Directorate, Naval Medical Research Center, Silver Spring, MD, USA

2Uniformed Services University of the Health Sciences, Bethesda, MD, USA

3Research and Diagnostic Center, Centers for Disease Control, Department of Health, 161 Kun-Yang Street, Taipei 11579, Taiwan

*Corresponding Author:
Chien-Chung Chao
Viral and Rickettsial Diseases Department
Infectious Diseases Directorate
Naval Medical Research Center
Silver Spring, MD, USA
E-mail: [email protected]

Received Date: May 07, 2012; Accepted Date: June 05, 2012; Published Date: June 12, 2012

Citation: Huber E, Ji D, Howell L, Zhang Z, Chen HW, et al. (2012) Loop-Mediated Isothermal Amplification Assay Targeting the 47-Kda Gene of Orientia tsutsugamushi: A Rapid and Sensitive Alternative to Real-Time PCR. J Med Microb Diagn 1:112. doi: 10.4172/2161-0703.1000112

Copyright: © 2012 Huber E, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Medical Microbiology & Diagnosis

Abstract

A sensitive, specific and rapid diagnostic test for the detection of Orientia tsutsugamushi, the causative agent of scrub typhus, is necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. A Loop-Mediated Isothermal Amplification (LAMP) assay targeting the 47-kDa gene of tsutsugamushi was developed. The LAMP assay was capable of detecting eleven different strains of Orientia at levels comparable to that of the quantitative PCR based method of detection. Ten patient specimens, confirmed to be positive for Orientia by two different PCR methods, were tested and nine out of ten were determined to be positive by LAMP. In terms of specificity, the assay was able to differentiate between Orientia and other phylogenetically similar bacteria as well as mouse and human host DNA. In addition to being sensitive and specific, the LAMP reaction was completed in 1 hour, demonstrating that it is a highly time-efficient method of diagnosing scrub typhus.

Introduction

Scrub typhus, a febrile illness caused by Orientia tsutsugamushi, is endemic to the Asia-Pacific region. The bacteria are transmitted to humans by the bite of larval trombiculid mites, commonly known as chiggers [1]. Approximately 1 million people are infected annually with many more at risk of acquiring infection [2]. The disease can account for up to 23% of febrile illnesses in the endemic region and can cause up to a 35% mortality rate if left untreated [3,4]. Scrub typhus has been re-emerging and occurring in new areas of many countries including Japan, Korea, Sri Lanka, China, Maldives, India, Palau, Malaysia, Taiwan, and Australia [5-14] and evidence of antibiotic resistance has been shown [15,16]. More recently, a new species of Orientia, Orientia chuto was identified in Dubai, where scrub typhus has not previously been described [17]. Furthermore, an endemic scrub typhus-like illness has been documented in Chile recently [18]. These observations clearly show that the disease is gradually expanding to various parts of the world and that there is an immediate need for an accurate method of detection that can cover a broad range of Orientia strains in different geographic regions.

The symptoms of scrub typhus, including fever, headache, and rash, are similar to those of other febrile diseases, making it difficult to differentiate between infections. In order to effectively deliver treatment to patients it is crucial for clinicians to have the ability to accurately distinguish between these symptomatically similar infections. Several methods are currently available for diagnosing scrub typhus including nucleic acid based detection and serological techniques. Although these methods are useful, they have limitations, especially in areas without sufficient resources. For example, quantitative real-time PCR or nested PCR targeting different genes, including the 56 kDa [19], 47kDa [20], GroEL [21], requires the use of an expensive, complex thermocycler which can be very difficult if not impossible to obtain and maintain in resource poor settings. Serological techniques are limited because they require a wait period for antibodies to be produced to a detectable level, and sometimes even healthy individuals in endemic areas can test positive due to the persistence of antibodies from previous scrub typhus infections [22]. Furthermore, the requirement for consistent and high quality antigen preparation has been an obstacle for the development of these assays. Therefore, there is an urgent need to develop a sensitive and specific assay that can be used in endemic areas where there are limited resources.

A Loop-Mediated Isothermal Amplification (LAMP) method has been extensively used as an alternative nucleic acid test to PCR or realtime PCR, and has demonstrated similar sensitivity levels for various infectious diseases [23-29]. Here we describe the detection of Orientia tsutsugamushi DNA by targeting the 47-kDa gene using LAMP. The 47- kDa gene sequence is highly conserved with >97% identity in 25 different strains of Orientia [30]. Therefore, the gene is an excellent target in achieving broad phylogenetic and geographic coverage. The LAMP assay was shown to be capable of detecting multiple strains of Orientia with high sensitivity levels similar to that obtained by real-time PCR using the same target. The presence of excess host genomic DNA or inclusion of near-neighbor rickettsial DNA did not interfere with the assay. Furthermore, when only near-neighbor rickettsial DNA was included in the reaction without Orientia template, no false positives were seen. In addition, the LAMP assay successfully identified PCRconfirmed, positive patient samples as positive for Orientia. These results suggest that the LAMP assay can substitute real-time PCR for the sensitive detection of Orientia DNA in resource-limited endemic areas.

Materials and Methods

Design of primers

Oligonucleotide primers used for the LAMP and quantitative PCR assays were designed based on the 47 kDa gene sequence from the Karp strain of O. tsutsugamushi. Two sets of primers, each consisting of two outer (F3 and B3) and two inner (FIP and BIP) primers, were used for the LAMP assay. All LAMP primers were designed using PrimerExplorer V4 (http://primerexplorer.jp/e/). The primers used for the quantitative PCR assay were designed based on previously described assays [21,29]. Two bases were changed from the reverse primer described by Paris et al. [29] to match the Karp strain sequence. All primers were synthesized by Eurofins MWG Operon (Huntsville, AL) and are described in Table 1.

  Primer Name   Length (bp)   Tm(°C)   Sequence 5’- 3’
  LAMP      
Primer Set 1 (#3)      
     F3 22 58.9 CTATTCATATGGGTAGCTTTGG
     B3 25 58.0 CCTAAATTCTCATTTAATTCTGGAG
     FIP 51 69.6 AGCAAAACTTATGCCTGAGTAAGAT-TTTTGACCGATGTTTAATCTTGAAGG
     BIP 50 69.7 CTGTACTTGAAGCAGTTGAATGCT-TTTTACATTTAACATACCACGACGAA
Primer Set 2 (#5)      
     F3 24 57.7 TGAAGTTATAAAAGAAGGATCTGC
     B3 23 57.4 GCTTTGATCATTACTTTGTTGCT
     FIP 47 70.0 ACCTGTAAATCTCTTCCTGTTTTGAT-TTTTGGAATTGCTCCTGGAGA
     BIP 49 70.6 CTGAAAGAGAAGTTGAGCTTTTACG-TTTTACTATCCTCACCTTTGTTGG
qPCR      
47kDa-F 28 58.8 AACTGATTTTATTCAAACTAATGCTGCT
47kDa-R 30 63.3 TATGCCTGAGTAAGATACGTGAATGGAATT

Table 1: Description of LAMP and qPCR primers.

Plasmid and genomic DNA template

The 47 kDa gene sequence of O. tsutsugamushi Karp strain was cloned into a VR1012 vector, the closed circular plasmid was purified using standard Qiagen plasmid mini kit following manufacturer's instruction. The pure plasmid was quantified spectrophotometrically and used as a standard to determine the best primer combination used in the LAMP assay. The optimized assay was then evaluated using genomic DNA material for sensitivity and specificity reported in the results. The genomic DNA template from multiple strains of O. tsutsugamushi including Karp, Gilliam, Kato, TA763, TH1811, TH1812, TH1814, AFC-1, Garton, Ikeda, and MAK119 were used as template in both LAMP and quantitative-PCR as described below. In addition to pure genomic DNA, genomic DNA in the presence of an abundance of nonspecific mouse or human DNA was also used. All genomic DNA was extracted as previously described [31]. Due to the limited amounts of starting materials (i.e., genomic DNA), select strains were amplified using the Illustra GenomiPhiV2 DNA Amplification Kit according to the manufacturer's instructions (GE Healthcare, Waukesha, WI) prior to performing the LAMP reaction [32].

Loop-mediated isothermal amplification reaction

LAMP reactions were carried out as described previously [33]. Briefly, the reactions were a total volume of 25 μL containing 1.6 μM of each FIP and BIP primer, 0.4 μM of each F3 and B3 primer, 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 8 mM MgSO4, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.8 M betaine (Sigma-Aldrich, St Louis, MO), 1.4 mM dNTP mixture (New England Biolabs, Beverly, MA), 8U Bst DNA polymerase (New England Biolabs, Beverly, MA), and DNA template. The reaction mixture, excluding Bst enzyme, was heated to 95°C for 5 min to denature the DNA template and then incubated on ice for 5 min. After denaturation of the DNA, the Bst DNA polymerase was added to the reaction mixture and the mixture was incubated at 60°C for 60 min. Each reaction was terminated by adding 5 μL of 10X BlueJuice™ (Invitrogen, Carlsbad, CA). The reaction product was electrophoresed on a 2% agarose gel stained with a 1:10,000 dilution of GelRed (Phenix Research Products, Asheville, NC) to visualize results.

kDa – based quantitative PCR

Quantitative PCR was performed to compare and to confirm the sensitivity of the LAMP assay. The 7500 Fast Real-time PCR System (Applied Biosystems, Foster City, CA) was used to perform the qPCR reactions and analyze the results. Primers designed against the 47-kDa gene sequence of the Karp strain of Orientia, described in previous studies were used (Table 1) [20]. The total volume of each reaction was 20 μL. Each reaction mixture contained 6 μM of the forward primer, 6 μM of the reverse primer, 1X RT2 SYBR Green qPCR Mastermix (SABiosciences, Frederick, MD), and DNA template. An initial 5 minute activation step at 95°C was followed by 40 cycles of 95°C for 10 seconds, 60°C for 30 seconds, and a melting curve determination cycle.

Results

The LAMP assay targeting the 47 kDa gene sequence of O. tsutsugamushi demonstrated high sensitivity and specificity. The sensitivity of the assay was first determined using plasmid DNA and pure Karp genomic DNA. The assay was able to detect down to 20 copies for both plasmid and genomic DNA template (data not shown). After the initial determination of sensitivity, 10 other strains of Orientia were tested to demonstrate the ability of the assay to detect a broad range of isolates. These are representative strains from different geographic areas within the Orientia triangle [34]. The LAMP assay was capable of detecting all other tested strains of Orientia, which included Kato, Gilliam, TA763, TH1811, TH1812, TH1814, AFC-1, Garton, Ikeda, and MAK119, with similar sensitivity. The sensitivity of the LAMP assay was comparable to that of qPCR (Table 2). Among the eleven strains tested, the detection limit for LAMP compared to qPCR was the same or lower for five strains. Among the remaining six strains, LAMP was able to detect between 16-50 copies/reaction.

Strain of Orientia  qPCR detection limit LAMP detection limit
     
Karp (WGA) 11 17
Gilliam 25  50
Kato 13 28
TA763 11 43
TH1811 4 4
TH1812 20 20
TH1814 1 1
AFC-1 5 5
Garton (WGA) 1 16
MAK119 2 20
Ikeda 9 9

Table 2: Detection limit of the LAMP assay compared to quantitative PCR.

DNA was extracted from the liver/spleen homogenate of mice challenged with different strains of O. tsutsugamushi in order to test the ability of the LAMP assay to detect Orientia in the presence of host DNA (at 1 Orientia DNA/1000 host DNA). The assay was able to detect the target DNA despite the abundance of mouse DNA in the sample (Figure 1). Additionally, in order to simulate the use of this assay in a true clinical setting, the LAMP assay was performed using DNA extracted from patient serum that was determined by two well-validated PCR analyses targeting 16s rRNA and the 56 kDa gene to be positive or negative for O. tsutsugamushi [35,36]. These DNA materials were kindly provided to us by Dr. Yupin Suputtamongkol (Siriraj Hospital, Mahidol University, Bangkok, Thailand). A total of 20 samples were tested, ten positive and ten negative. Of the ten positive patient samples that were confirmed positive by PCR, the LAMP assay detected nine out of the ten as being positive. Among these samples the Karp, Gilliam, Kato, and TA763 strains of Orientia were represented. The false negative was determined to be of the Kato strain of Orientia. Of the ten PCR-confirmed negative patient samples, the LAMP assay determined eight out of the ten samples to be negative. The other two samples showed a positive signal with a similar banding pattern to the Orientia positive samples (Table 3).

Sample 47 kDa gene (accession #) Geographic location Diagnosis* (strain)
L1 + (L31934) New Guinea ST (KARP)1
L2 + (L31933) Burma ST (GILLIAM)2
L3 + (L31933) Burma ST (GILLIAM)
L4 + (L31934) New Guinea ST (KARP)
L5 + (L31934) New Guinea ST (KARP)
L6 + (L11697) Japan ST (KATO)3
L7 + (HM595490) Thailand ST (TA763)4
L8 - (L11697) Japan ST (KATO)
L9 + (L11697) Japan ST (KATO)
L10 + (L31934) New Guinea ST (KARP)
L11  (-)   MT
L12  (-)   MT
L13  (-)   LEPTO.
L14  (-)   LEPTO.
L15  (+)   MALARIA(PF)
L16  (-)   MALARIA(PF)
L17  (-)   DENGUE
L18  (-)   DENGUE
L19  (-)   HEALTHY
L20  (+)   HEALTHY

Table 3: Evaluation of LAMP assay using the 47 kDa gene as the target with PCR confirmed positive and negative samples.

medical-microbiology-diagnosis-LAMP-assay

Figure 1: LAMP assay performed using total DNA purified from mouse liver/ spleen homogenate, known to contain the Karp strain of Orientia. Lane 1: 100bp DNA ladder, Lane 2: positive control, Lane 3: negative control, Lane 4-6: products from LAMP reaction containing different copies (lane 4-6 has 20,000, 2,000, and 200 copies, respectively) of Orientia DNA and an overabundance (1,000 fold excess) of mouse DNA.

The specificity of the LAMP assay was also demonstrated by using purified DNA from bacteria that are phylogenetically close to Orientia as the template. LAMP reactions containing R. conorii, R. prowazakii, R. belli, R. rickettsii, R. typhi, R. felis, C. burnetii, or L. interrogans DNA as template all tested negative (Figure 2A). Addition of the Karp strain of Orientia at 1/10 of DNA copy of other DNA resulted in positive results for all reactions, indicating that the assay is specifically detecting Orientia and sensitive enough to detect the desired target in the presence of other phylogenetically close genomic DNA (Figure 2B).

medical-microbiology-diagnosis-positive-control

Figure 2: Demonstration of specificity of the LAMP assay. A) Lane 1: 100bp ladder, Lane 2: negative control, Lane 3: positive control, Lane 4-11: products from LAMP reactions containing genomic DNA from bacteria which are phylogenetically similar to Orientia including R. conorii R. prowazakii, R. belli, R. rickettsii, R. typhi, R. felli, C. burnetii, and L. interrogans, respectively. B) LAMP assay performed using a combination of Orientia genomic DNA and other bacterial genomic DNA. Lane 1: 100 bp ladder, Lane 2: negative control, Lane 3: positive control, Lane 4-11: O.tsu + R. conorii, O.tsu + R. prowazakii, O.tsu + R. belli, O.tsu + R. rickettsii, O.tsu + R. typhi, O.tsu + R. felli, O.tsu + C. burnetii, and O.tsu + L. interrogans, respectively.

Discussion

The 47 kDa gene sequence was selected as a target for the LAMP assay because it is very conserved among the different strains of Orientia with the exception of O. chuto [18]. As stated previously, the 47 kDa gene has >97% identity in 25 different strains of Orientia [5,22]. The ability of this LAMP assay to cover a broad range of isolates was shown. This indicates that the assay could be utilized in various geographic settings. The strains able to be detected by the LAMP assay are endemic to multiple countries including Thailand, Taiwan, Japan, New Guinea, Australia and Burma [34].

During the optimization process of the development of the LAMP assay, several sets of primers were screened individually and in combination. Combining two sets of primers without loop primers was proved to be more sensitive in amplifying the target DNA than using one set alone. It should be noted that while an incorrect loop primer was mistakenly added to LAMP reactions during some trials with the Karp and Gilliam strains initially, follow up experiments conducted confirmed that this error did not interfere with the reaction (the LAMP detection limit with the incorrect loop primer was 6 copies and 55 copies for Karp and Gilliam, respectively, Table 2). This is consistent with the notion that the primary function of loop primers is to accelerate the reaction and not to improve sensitivity or specificity [37]. To further increase the sensitivity of the assay, a TTTT-linker was added to the inner primer sequences, which allows the primers to have more physical flexibility in binding to the target DNA. Temperatures ranging between 59 and 65°C were tested to determine the optimal incubation temperature for the LAMP reaction. Sixty degrees was the temperature at which the assay performed with the highest sensitivity. Also in an effort to increase the sensitivity of the assay, the DNA template was denatured to increase the amount of exposed single stranded DNA to which the primers could bind to. In addition to the method used, denaturing the DNA after adding it to the reaction mixture, a second method was tested in which the DNA was denatured prior to adding it to the reaction mixture. The latter method was found to be less efficient as the method that was used for this study. The primers being present in the mixture when the DNA is denatured likely increases the amount of primer that will anneal to the DNA.

Whole genome amplification (WGA) was performed using the Illustra GenomiPhiV2 DNA Amplification Kit with the Karp and Garton strains of Orientia to obtain more genomic material prior to running the LAMP assay. This was due to the limited amount of pure DNA material from these two strains. Kato et al. [32] had shown that WGA of low amounts of rickettsia DNA in the presence or absence of host DNA material could lead to an increased amount of rickettsial DNA available as template for downstream qPCR amplification. The WGA reaction used in this study also showed amplification of Orientia DNA and subsequent detection by LAMP and qPCR. It was not clear whether there was a difference in efficiency of amplification of Orientia DNA with or without the presence of host DNA material. Nevertheless, it appeared that both genomic materials were amplified when WGA was applied. The use of WGA posed an uncertainty as to whether the 47 gene sequence would be over-amplified during this procedure. Therefore, quantitative PCR was performed and it was confirmed that the 47 gene sequence was not over-amplified and that the amplification process did not alter the genomic DNA or the interpretation of the results (data not shown). This observation suggests that WGA can be incorporated in the sample preparation step to increase the amount of target DNA for a subsequent PCR or real-time PCR assay. Alternatively, WGA can be applied to hard-to-get DNA samples in order to preserve the precious material for downstream applications.

The one confirmed-positive clinical sample that was not detected as positive by LAMP was characterized and found to be of the Kato strain. This is the only one among the three Kato strain positives that was not detected by LAMP. It is not clear why this particular Kato strain infected patient sample was not detected by LAMP. One possibility is that there was a low amount of DNA extracted from this sample, or that the target region of the LAMP primers, the 47 kDa gene sequence, was not available in the purified DNA material, as the PCR assays originally determining positive or negative status targeted the 56 kDa and 16s rRNA genes. We performed additional experiments to confirm the presence of the 56 kDa gene using nest PCR [30] and were not able to detect the gene. Even after whole genome amplification of the original DNA material followed by nest PCR, we were not able to detect the 56 kDa gene. The WGA amplified material was not positive by LMAP assay either (data not shown). Therefore, it is possible that this sample was misdiagnosed as scrub typhus patient serum.

The assay demonstrated high specificity when tested with DNA template that was phylogenetically close to that of Orientia. However, two out of ten clinical samples that were PCR-confirmed negatives were tested positive by the LAMP assay. Given that the banding pattern for these two samples was similar to that of Orientia positive, it is reasonable to think that these samples were positive due to contamination by Orientia genomic material and not because the primers were nonspecifically binding to the host or other DNA. Further experiments to demonstrate the specificity of the current LAMP assay by eliminating contamination are desirable and more clinical samples shall be tested to evaluate the clinical usage of the assay. Two recent publications by Blacksell et al. [38] and Paris et al. [39] have examined the clinical usage of the LAMP assay targeting the groEL gene individually or in combination with serological assays using well-characterized scrub typhus patient samples. It was concluded that the use of either a serological assay or LAMP assay alone would not provide desired levels of sensitivity and specificity. The combination of both serological assay and nucleic acid detection covering a complete time frame during the progression of disease is the best clinical practice for accurate diagnosis of the disease. However, the cost of performing both serological assay and nucleic acid test (i.e. qPCR or PCR) in low resource, endemic areas can be substantial. With the development of an immunochromatographic test for serological testing and the less expensive, qPCR comparable LAMP assay, it is possible to perform both assays in parallel at an affordable price to provide timely and accurate diagnosis for proper treatment.

Acknowledgements

The authors wish to thank Dr. Yupin Suputtamongkol and her associates to provide DNA extracted from clinical samples. These samples were confirmed as positive or negative using PCR. This work was supported by Work Unit Number (WUN) 6000.RAD1.J.A0310. The opinions and assertions contained herein are the private ones of the authors and are not to be construed as official or as reflecting the views of the Department of the Navy, the Naval service at large, the Department of Defense, or the U. S. Government. Authors Chien-Chung Chao and Wei-Mei Ching are employees of the U. S. Government. This work was prepared as part of official duties. Title 17 U.S.C. §105 provides that 'Copyright protection under this title is not available for any work of the United States Government.' Title 17 U.S.C. §101 defines a U.S. Government work as a work prepared by employee of the U.S. Government as part of that person's official duties.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 10th World Congress on Alzheimers Disease & Dementia
    May 30-31, 2018 Osaka, Japan
  • 4th World Congress and Exhibition on Antibiotics and Antibiotic Resistance
    June 14-15, 2018 Barcelona, Spain
  • 4th Annual Congress on Infectious Diseases  
    September 17-18, 2018 San Diego, USA
  • 13th World Congress on Virology
    September 26-27, 2018 Montreal, Canada

Article Usage

  • Total views: 11648
  • [From(publication date):
    October-2012 - Nov 22, 2017]
  • Breakdown by view type
  • HTML page views : 7865
  • PDF downloads : 3783
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords