alexa Molecular Characterization and Antimicrobial Susceptibility Study of Acinetobacter baumannii Clinical Isolates from Middle East, African and Indian Patients | Open Access Journals
ISSN: 0974-276X
Journal of Proteomics & Bioinformatics
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Molecular Characterization and Antimicrobial Susceptibility Study of Acinetobacter baumannii Clinical Isolates from Middle East, African and Indian Patients

Manu Chaudhary and Anurag Payasi*

Department of Cell Culture and Molecular Biology, Venus Medicine Research Centre, Baddi, Himachal Pradesh, India

*Corresponding Author:
Anurag Payasi
Venus Medicine Research Centre
Hill Top Industrial Estate
Bhatoli Kalan, Baddi, H.P. - 173205 India
Tel: +91-1795-302005
Fax: +91-1795-302133
E-mail: [email protected]

Received Date: October 29, 2012; Accepted Date: November 15, 2012; Published Date: November 19, 2012

Citation: Chaudhary M, Payasi A (2012) Molecular Characterization and Antimicrobial Susceptibility Study of Acinetobacter baumannii Clinical Isolates from Middle East, African and Indian Patients J Proteomics Bioinform 5: 265-269. doi: 10.4172/jpb.1000248

Copyright: © 2012 Chaudhary M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Proteomics & Bioinformatics

Abstract

The aim of the present investigation was to characterize the prevalence of extended-spectrum β-lactamases (ESBLs) and metallo β-lactamases (MBLs), and to study the antibiotic susceptibility profile among 250 clinical isolates of Acinetobacter baumannii. Phenotypic characterization was carried out by double disc synergy method and the prevalence of ESBLs and MBLs antibiotic resistant determinants were analyzed with Polymerase Chain Reaction (PCR). Susceptibility studies were performed by disc diffusion method according to Clinical and Laboratory Standards Institute guidelines 2009.
Among the two hundred fifty isolates, two hundred nine isolates (83.6%) were positive for ESBLs whereas one hundred sixty seven isolates (79.9%) were positive for both ESBLs and MBLs. Moreover, five isolates (2.3%) which were positive for MBL on disc diffusion test, but negative in PCR showed MBL activity by spectrophotometric assay. Susceptibility study showed that all of the isolates were found to be more susceptible to ceftriaxone plus ethylenediaminetetraacetate plus sulbactam (90-93%), followed by meropenem (50-53%), imipenem (42-45%), cefoperazone plus sulbactam (40-42%), piperacillin plus tazobactam (38-42%) and amoxicillin plus clavulanic acid (28-31%). Among the ESBLs, TEM-types were varied from 82 to 87% followed by SHV-types (67-78%), CTX-M types (60 to 67) and OXA types (51 to 56%) in all of the isolates. Among the MBLs, NDM-1 varied from 40 to 49% followed by IMP-1 (51 to 55%), VIM-1 (55 to 59%) and KPC (47 to 55%) in all of the isolates. Moreover, results of the present study revealed that all of the clinical isolates were susceptible to ceftriaxone plus EDTA plus sulbactam and can be a potent antibacterial agent for the treatment of severe bacterial infections caused by A. baumannii.

 

Keywords

Acinetobacter baumannii; Clinical isolates; Susceptibility; Extended-spectrum β-lactamases; Metallo β-lactamases

Introduction

Acinetobacterspecies are aerobic gram-negative organism being responsible for various types of infections such as pneumonia, urinary tract infection and septicemia [1-4]. The Acenitobacter infections have been recognized as an emerging problem and appeared to be associated with high mortality rates throughout the world. Very recently, it has been reported that Acinetobacter species accounts for 10% of community-acquired bacteraemia in Kenyan hospital and the prevalence of antibiotic resistance among Acinetobacter baumannii isolates in Syria have been increasing in recent years [5,6]. The overall prevalence of nosocomial infections in hospital intensive care units due to Acinetobacter baumannii varies from 2 to 10% [7]. The infections caused by Acinetobacter are often treated with cephalsporins including ceftazidime, ceftriaxone, aminoglycosides such as tobramycin and amikacin, carbapenems, and tetracycline. However, to date, most strains of A. baumannii have become increasingly resistant to almost all these currently available antibacterial agents [4].

According to a surveillance study conducted at 40 centers in 12 countries revealing a substantial increase in resistance rates in Acinetobacter species for meropenem (43.4%) and imipenem (42.5%) [8]. The prevalence of imipenem resistance in Acinetobacter baumannii isolated from a burns unit of United State America was found to be 87% [9]. Similarly, according to a surveillance study conducted in several regions of Greece between 1996 and 2007, A. baumannii shows resistant to imipenem up to 85% (ICUs), 60% (medical wards), and 59% (surgical wards) [Greek System for Surveillance of Antimicrobial Resistance (GSSAR): http://www.mednet.gr/whonet/].

In India, it has been demonstrated that approximately 35% Acinetobacter species found to be resistant to carbapenem drugs and the prevalence of carbapenem resistance is increasing greatly in Acinetobacter species [3,10]. Among the factors thought to contribute antibiotic resistant development in A. baumannii, Extended-Spectrum β-Lactamase (ESBL) production [11], Metallo-β-Lactamases (MBLs) production [10,11] are predominant. Szabo et al. [11] reported that MBLs cause resistance to all β-lactam antibiotics except monobactam.

In view of the above data, the increasing rate of the antibiotic resistance and its impact on treatment failure compelled us to think a new means by which the increasing mortality rate because of failure of drug therapy can be controlled. We studied the susceptibility of different antibiotics and compared it with a newly launched patent protected drug having a non-antibiotic adjuvant along with β-lactam and β-lactamase inhibitor which altogether termed as ceftriaxone plus Ethylenediamine Tetraacetic Acid Disodium (EDTA) plus sulbactam. Therefore, the aim of this study was to characterize the prevalence of ESBLs and MBLs, and to study the antibiotic susceptibility profile among 250 clinical isolates of Acinetobacter baumannii collected from different hospitals of India, Kenya, Uganda, and Syria. This work illustrates that ceftriaxone plus EDTA plus sulbactam appear to be most active against both ESBLs and MBLs producing A. baumannii.

Materials and Methods

Antimicrobial agents

Ceftriaxone plus EDTA plus sulbactam (Ceftriaxone: Sulbactam :: 2:1 with 10 mM EDTA disodium), ceftriaxone (Rocephion, Hoffmann-Laroche Pharmaceutical Limited, Basel Switzerland), amoxicillin plus clavulanic acid (Augmentin, Glaxo Smith Kline, Pharmaceuticals Limited, Mumbai, India), piperacillin plus tazobactam (Zosyn; Wyeth Pharmaceuticals, India, Mumbai), meropenem (Meronem, Astrazeneca Pharma India Limited, Banglore, India), cefoperazone plus sulbactam (Magnex, Pfizer Limited, Mumbai, India) were used in the study. All the drugs were reconstituted according to the instructions of manufacturer prior to use. Working solutions were prepared using MH broth (Mueller Hinton, Himedia, Mumbai, India) and serial two fold dilutions were made using CAMH (Cation-Adjusted Mueller-Hinton, Himedia, Bombay, India) broth in wells of 96-well plate.

Collection of clinical isolates and their identification

A total of 250 multi-drug resistant clinical isolates of A. baumannii collected between January 2010 to April 2012 from different hospitals of India, Kenya, Uganda, and Syria. The isolates were from various clinical specimens such as pus (n = 42), blood (n = 95), sputum (n = 68), urine (n = 45). The identity of all strains were reconfirmed by morphologically and conventional biochemical methods [12]. Prior to use, all the samples were inoculated on Mac-Conkey's and blood agar, incubated at 37°C for overnight and colonies were processed. In case of blood sample, blood was incubated at 37°C overnight in brain heart infusion broth. A drop of brain heart infusion broth was inoculated on Mac-Conkey agar and blood agar and incubated at 37°C for overnight. For each isolates, three to five colonies were transferred into 10 ml of cation adjusted Mueller-Hinton broth (CAMHB, Himedia, Mumbai, India) and incubated at 37°C overnight on a rotary shaker at 150 rpm to obtain a planktonic culture in exponential growth phase. This bacterial suspension was used as the inoculum at a concentration of 106 colony-forming units (cfu/ml).

Screening of A. baumannii clinical isolates for ESBL and MBL

Screening of all clinical isolates was done according to Clinical and Laboratory Standards Institute (CLSI) guidelines [13].

Phenotypic ESBL detection

ESBL production among the clinical isolates was confirmed by phenotypic test [13]. Lawn culture of the organism was made and a disc of 3rd-generation cephalosporins (ceftazidime, cefotaxime and ceftriaxone) and in combination with clavulanic acid disc was placed with 25mm apart. A ≥ 5 mm increase in a zone diameter for either antimicrobial agents tested in combination with clavulanic acid versus its zone when tested alone confirms an ESBL-producing organisms. The clinical isolates which were positive for ESBL by the double disc synergy test but PCR-negative were further tested for ESBL enzyme activity spectrophotometrically as described earlier [14]. K. pneumoniae ATCC 700603, (ESBL positive), Escherichia coli ATCC 35218 (TEM-1 positive), negative), and A. baumannii MTCC 1425 (ESBL negative) strains were used as control throughout the study.

Phenotypic MBL detection

Phenotypic detection of MBLs among the A. baumannii clinical isolates was carried out using imipenem (10 μg) and imipenem (10 μg) + EDTA (750 μg) discs as described elsewhere [15]. The test organism was inoculated onto Mueller-Hinton agar (MHA, Himedia, Mumbai, India) and an increase of 7 mm or more in zone diameter in the presence of EDTA compared to imipenem tested alone was considered to be a positive test for the presence of an MBL. The clinical isolates which were positive for MBL by the double disc synergy test but PCR-negative were further tested for MBL enzyme activity spectrophotometrically as described previously [16]. The strains Klebsiella pneumoniae BAA-2146, Klebsiella pneumoniae BAA 1705 and Pseudomonas aeruginosa ATCC 27853 were used as control throughout study.

Preparation of template DNA

5ml of each bacterial culture was centrifuged at 5000 rpm for 5 min at 4°C and resulting pellet was washed once in Tris-EDTA (TE) buffer (Tris-HCl 1.0 M, pH 8.0; EDTA 0.5 M, pH 8.0). After addition of 300 μl of TE buffer, 40 μl of 10% SDS (sodium dodecyl sulfate), 3 μl of 0.5 M EDTA (pH 8.0) incubated for 5 min at 65°C. Following incubation, 750 μl of isopropanol was added and centrifuged at 14000 rpm for 5 min at 15°C. The resulting pellet was resuspended in 500 μl of TE and 2 μl of RNase (10 mg/ml) and incubated at 65°C for 30 min, then added 2 μl of proteinase K (20 mg/ml) and again incubated at 37°C for 15 min. Following incubation, 1 ml of phenol: chloroform (1:1) was added. The upper phase was transferred to another tube and added equal amount of chloroform, shaken well and centrifuged at 14000 rpm for 5 min at 15°C. The supernatant was provided with 40 μl of 5 M Na-Acetate (pH5.2) and 1 ml of ethanol and left at room temperature for 1 h, centrifuged at 7000 rpm for 5 min at 4°C. The DNA pellet was washed with 70% ethanol and suspended in 50 μl of TE buffer. DNA purity and concentration were assayed in a spectrophotometer (260/280).

Detection of ESBLs and MBLs types by PCR

All of the the isolates phenotypically positive for ESBL and MBL were checked for ESBLs and MBLs genotypically by PCR. PCR analysis for β-lactamase and metallo β-lactamase genes was carried out using the previously reported specific oligonucleotide primers shown in the table 1. All of the primers were procured from Sigma Aldrich Chemicals Private Limited, Banglore, India. For PCR amplifications, about 200 pg of DNA was added to 20 μl mixture containing 0.5 mM of dNTPs, 1.25 μM of each primer and 3.0 U/μl of Taq polymerase (Bangalore Genei) in 1x PCR buffer. Amplification was performed in an Eppendorf thermal cycler (Germany). The amplified products were separated in 1.5% agarose gel containing 4 μl of 10 mg/ml of ethidium bromide. The gel was run at 70 volt for 1 h. The gel images were taken under ultraviolet light using gel documentation system (Bio-Rad, USA). A 100 bp ladder molecular weight marker (Bangalore Genei) was used to measure the molecular weights of amplified products. The images of ethidium bromide stained DNA bands were visualized using a gel documentation system (Bio-Rad, USA).

Primer Primer sequences (5'-3') Amplicon (base pair) References
TEM-1 F-TCGGGGAAATGTGCG
R-TGCTTAATCAGTGAGGCACC
966 [31]
TEM-2 F-ATCAGCAATAAACCAGC
R-CCCCGAAGAACGTTTTC
516 [32]
TEM- 50 F-GAAGACGAAAGGGCCTCGTG
R-GGTCTGACAGTTACCAATGC
264 [33]
SHV -1 F- TAAGCGAAAGCCAGCTGTCG
R- TTTCGCTCCAGCTGTTCGTC
178 [34]
SHV-10 F-CCGATAAGACCGGAGTTCGC
R-AGTCATATCGCCCGGCAC
248 [35]
CTXM-9 F-TACCGCAGATAATACGCAGGTG
R-CAGCGTAGGTTCAGTGCGATCC
355 [36]
CTXM- 10 F- CGTGCTTTGTAAAAGTAGCAG
R- CATGATTTTGGTGGGAATGG
534 [37]
CTXM-15 F- AATCACTGCGCCAGTTCACGCT
R- GAACGTTTCGTCTCCCAGCTGT
479 [36]
OXA-11 F- AACTATGATTGGGGATTGAG
R- TCAACAAATCGCCAGAGAAG
276 [38]
NDM-1 F-GGTTTGGCGATCTGGTTTTC
R- CGGAATGGCTCATCACGATC
621 [39]
VIM-1 F-GATGGTGTTTGGTCGCATA
R- CGAATGCGCAGCACCAG
390 [40]
IMP- 1 F- GGAATAGAGTGGCTTAAYTC
R- CCAAACYACTASGTTATCT
188 [40]
KPC-1 F-CTTGCTGCCGCTGTGCTG
R- GCAGGTTCCGGTTTTGTCTC
489 [41]
KPC-2 F- GCTACACCTAGCTCCACCTTC
R- GCATGGATTACCAACCACTGT
989 [42]

Table 1: Oligonucleotides used in the study for each tested genes.

Antimicrobial susceptibility study

Disc diffusion method: The antimicrobial susceptibility testing of the following drugs were determined by the disc diffusion method according to the Clinical Laboratory Standards Institute guidelines [13]. Antibiotic tested included ceftriaxone plus EDTA plus sulbactam (30:10:15 μg), piperacillin plus tazobactam (100:10 μg), amoxicillin plus clavulanic acid (20:10 μg), cefoperazone plus sulbactam (75:30 μg), imipenem (10 μg) and meropenem (10 μg). The quality control strains were the same which mentioned above. The results were interpreted using the CLSI, 2009 guidelines [13].

Results

Morphological and biochemical characterization

All of the clinical isolates obtained from various clinical specimens identified as A. baumannii based on their morphological and biochemical characterization.

Screening of ESBLs and MBLs

Out of the 250 clinical isolates of A. baumannii, 209 (83.6%) were found to be ESBLs positive with ceftazidime/clavulanate and PCR, and 167 isolates were MBL positive as evident through imipenem/EDTA and PCR study. Five clinical isolates (2.3%) which were positive for MBLs on disc diffusion test but negative in PCR showed MBL activity by spectrophotometric assay indicating involvement of other genes which were not included in the study. The overall prevalence of ESBLs and MBLs in A. baumannii isolates varied from sample to sample.

Diversity of ESBLs and MBLs

Table 2 shows the prevalence of ESBLs and MBLs in different clinical isolates. TEM-type ESBLs (blaTEM-1, blaTEM-2, and blaTEM-50) were varied from 82 to 87% in all of the isolates obtained from pus, blood, sputum and urine. SHV-type ESBLs (blaSHV-1and blaSHV-10) ranged from 67 to 78%, CTX-M type ESBLs (CTX-M-9 and CTX-M-15) were ranged 60 to 67 and OXA type ESBLs (blaOXA11) varied from 51 to 56%. Among the MBLs, NDM-1 varied from 40 to 49%, IMP-1 varied from 51 to 55%, VIM-1 varied from 55 to 59% and KPC (KPC-1 and KPC-2) ranged from 47 to 55% in all of the isolates.

ESBL positive isolates (n=209) MBL positive isolates (n=167)
  TEM-1 TEM-2 TEM-50 SHV-1 SHV-10 CTX-M-9 CTX-M-15 OXA-11   NDM-1 IMP-1 VIM-1 KPC-1 KPC-2
Pus (n=35) 11 10 8 16 10 11 10 18 Pus (n=27) 11 15 16 8 7
Blood (n=84) 27 28 12 35 31 31 26 44 Blood (n=71) 35 39 41 16 18
Sputum (n=55) 22 18 08 19 18 18 15 31 Sputum (n=42) 18 23 25 11 12
Urine (35) 14 13 03 13 11 10 13 19 Urine (27) 13 14 15 6 8

Table 2: Distribution of ESBLs and MBLs genes among clinical samples of A. baumannii.

Antimicrobial susceptibilities of clinical isolates

A significant difference in resistant and susceptibility pattern was observed with the drugs used in the study against the clinical isolates. An antibiogram of the isolates was presented in table 3. Of the 206 isolates of A. baumannii tested for their antibiogram, more than 90-93% isolates have shown susceptibility to ceftriaxone plus EDTA plus sulbactam and 7-10% were resistant. Amoxicillin e plus clavulanic acid showed the highest percentage of resistance varying from 65 to 76% in various clinical specimens such as, pus, blood, sputum and urine followed by piperacillin plus tazobactam (46-62%), cefoperazone plus sulbactam (51-60%), imipenem (54-58%) and meropenem (46-50%).

S. No Name ofantibiotic Clinical isolates from pus (n= 42) Clinical isolates from blood (n=95) Clinical isolates from sputum (n=68) Clinical isolates from urine (n=45)
Susceptibility Resistant Susceptibility Resistant Susceptibility Resistant Susceptibility Resistant
No of isolates % No of isolates % No of isolates % No of isolates % No of isolates % No of isolates % No of isolates % No of isolates %
1 Ceftriaxone +EDTA+ sulbactam 38 90.47 4 9.5 88 92.63 7 7.36 62 91.11 6 8.82 42 93.33 3 6.66
2 Piperacillin + Tazobactam 16 38.05 24 62 41 43.15 54 56.84 27 39.7 41 60.29 19 42.2 26 57.77
3 Amoxycillin + Clavulanic acid 12 28.57 30 71.42 33 31.57 62 65.26 16 23.52 52 76.47 14 31.11 31 68.88
4 Cefoperazone +Sulbactam 17 40.47 25 59.52 38 40 57 60 29 42.64 39 57.35 18 40.0 27 60.0
5 Imipenem 19 45.23 23 54.76 40 42.10 55 57.89 31 45.58 37 54.41 20 44.44 25 55.55
6 Meropenem 21 50 21 50 47 47.47 48 50.52 37 54.41 31 45.58 24 53.33 21 46.66

Table 3: Antibiogram of clinical isolates of A. baumannii.

Discussion

In recent years, the increasing resistance to antibiotics has alarmed the whole world. Production of β-lactamases and metallo-β-lactamases has been one of the important resistance mechanism of many bacterial species particularly in the Enterobacteriacae [10,17-19]; high prevalence of ESBLs and MBLs producing A. baumannii strains has been documented by various groups [3,5,6,10]. In the present study, the percentage of ESBLs and MBLs in A. baumannii clinical isolates ranged from 50% to 85% and 40% to 59%, respectively. Previous studies have reported ESBL production varying from 68%-75% [11,20,21], where as MBL producing organism ranged from 28 to 42% [10,19], very recently, Jaggi et al. [22] reported that the A. baumannii obtained from entire hospital showed 89.6% carbapenem resistance, this resistance increased to 93.2% in ICU clinical samples. Antibiotic resistance in A. baumannii is increasing at an alarming rate leading to increased morbidity, mortality at ICU settings as revealed by surveillance studies from Europe, Asia pacific region, Latin America and North America over the last 3-5 years [23].

In the present study, the highest percentage of ESBL producers were observed in isolates obtained from blood 88.42% (84 isolates) followed by sputum 81% (55 isolates), pus 83.33% (35 isolates) and urine77.77% (35 isolates). Similarly, the highest percentage of occurrence of MBL was reported in blood 74.73% (71 isolates) followed by sputum 61.76% (42 isolates), pus 64.28% (27 isolates) and urine 60% (27 isolates) (Table 3). Roy et al. [24] from India isolated twelve isolates of A. baumannii from blood culture of septic neonates during 2007 and 2008 and reported 33.33% isolates were carbapenem resistant.

The antibiogram clearly showed an increasing resistance of A. baumannii to various antibiotics. However, ceftriaxone plus EDTA plus sulbactam was active more than 90% of A. baumannii clinical isolates obtained from pus, blood, sputum and urine. Amoxicillin e plus clavulanic acid showed the highest percentage of resistance varying from 65 to 76% followed by piperacillin plus tazobactam (46-62%), cefoperazone plus sulbactam (51-60%), imipenem (54-58%) and meropenem (46-50%). Several authors have documented on the reduced susceptibility to imipenem and meropenem among A. baumannii isolates [3,10,24-26]. Prakasam et al. [27] demonstrated that A. baumannii showed 80.4% resistance against piperacillin plus tazobactam and 63% resistance to meropenem. Another study conducted by Kaul et al. [28] reported the increased carbapenem resistance in gram negative bacilli. Simillarly, Srinivasa Rao et al. [29] has reported high level of resistance (> 75%) to both carbapenem and other antibiotic routinely used for the treatment of gram negative bacilli.

Interestingly, ceftriaxone plus EDTA plus sulbactam showed intermediate to resistant response to those strains which were positive with higher classes of TEM and OXA including TEM-50, OXA-11, whereas piperacillin plus tazobactam, amoxicillin plus clavulanic acid, cefoperazone plus sulbactam, imipenem and meropenem were resistant to those isolates were positive with MBL gene including NDM-1, VIM-1, KPC-1, KPC-2, IMP-1 and ESBL genes such as TEM-50 and OXA-11 [21]. However, ceftriaxone plus EDTA plus sulbactam appeared to be highly susceptible to MBL positive genes including NDM-1, VIM-1, KPC-2, IMP-1.

Multi-drug resistant A. baumannii bacteria remain an important cause of infection around the world. Ceftriaxone plus EDTA plus sulbactam is active against A. baumannii isolates of pus, blood, sputum and urine origin, even when susceptibility to other drugs has been lost. Thus, in case of infection with multidrug-resistant A. baumannii, ceftriaxone plus EDTA plus sulbactam can be drug of choice.

Acknowledgements

Authors are thankful to sponsor, Venus Pharma GmbH, AM Bahnhof 1-3, D-59368, Werne, 198 Germany, for providing assistance to carry out this study. Also thankful to institutes which provided clinical isolates.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 9th International Conference on Bioinformatics
    October 23-24, 2017 Paris, France
  • 9th International Conference and Expo on Proteomics
    October 23-25, 2017 Paris, France

Article Usage

  • Total views: 11733
  • [From(publication date):
    November-2012 - Oct 24, 2017]
  • Breakdown by view type
  • HTML page views : 7919
  • PDF downloads :3814
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords