alexa A Highly Sensitive and Specific Conventional Molecular Diagnosis for Leishmania infantum Chagasi Based on a Single Copy Gene | OMICS International
Journal of Molecular Biomarkers & Diagnosis
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

A Highly Sensitive and Specific Conventional Molecular Diagnosis for Leishmania infantum Chagasi Based on a Single Copy Gene

Rodrigo Buzinaro Suzuki1,2, Aline Diniz Cabral1, Renata Tonhosolo1, Arlei Marcili3, Camila de Oliveira Campos Camargo Sanches1,Luciamare Perinetti Alves Martins4 and Márcia Aparecida Sperança1*

1Center for Natural and Human Sciences, Universidade Federal do ABC, São Bernardo do Campo, São Paulo, Brazil

2Department of Genotyping, Hemocenter, Marilia Medical School, Marilia, São Paulo, Brazil

3Departamento de Medicina Veterinária Preventiva e Saúde Animal, Faculdade de Medicina Veterinária, Universidade de São Paulo, São Paulo, Brasil

4Discipline of Parasitology, Marilia Medical School, Marilia, São Paulo, Brazil These authors contributed equally to this work

*Corresponding Author:
Márcia Aparecida Sperança
Universidade Federal do
ABC - Center for Natural and Human Sciences
Rua Arcturus, 03 - Bloco Delta
Sala 226, Laboratório 105
CEP 09606-070 São Bernardo do Campo - São Paulo – Brazil
Tel: 55.11.2320 6253/6187
E-mail: [email protected]

Received Date: December 09, 2015; Accepted Date: December 24, 2015; Published Date: December 26, 2015

Citation:Suzuki RB, Cabral AD, Tonhosolo R, Marcili A, Sanches COCC, et al. (2015) A Highly Sensitive and Specific Conventional Molecular Diagnosis for Leishmania infantum Chagasi Based On a Single Copy Gene. J Mol Biomark Diagn 7:269. doi:10.4172/2155-9929.1000269

Copyright: © 2015 Suzuki RB, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Molecular Biomarkers & Diagnosis


Leishmaniasis are zoonotic diseases caused by a protozoa from Trypanosoma family and of the genus Leishmania, being transmitted by sandfly vectors. Leishmania genus comprise 30 species, including 20 species able to cause disease with different clinical manifestations in humans, ranging from asymptomatic, cutaneous and mucocutaneous lesions, to the severe visceral form. According to the World Health Organization, visceral leishmaniasis, caused by Leishmania infantum chagasi in the Americas, is the most severe form of the disease, and is lethal if not treated. Brazil is part of the group of countries with the highest prevalence of this disease, concentrating 90% of the cases registered in Latin America. A rapid and accurate diagnostic method is of great importance to detect and treat specifically L. i. chagasi in the American continent where others trypanosomiasis circulate, making a specific diagnostic difficult, due to cross reaction. In this work, a new conventional molecular diagnostic method was developed, based on the single copy L. infantum chitinase encoding gene, which presented high specificity and showed increased sensitivity when compared to the method based on the gene encoding the internal transcribed spacer 1 of the Leishmania rRNA (rDNA ITS-1) to diagnose L. i. chagasi on human clinical samples.


Leishmania infantum chagasi; Molecular diagnose; Visceral leishmaniasis; Chitinase; rDNA ITS-1; Single copy gene


The genus Leishmania, an important group of parasites transmitted by the bite of infected phlebotomine sandflies to different species of lizards and mammals, including humans [1], is the causative agent of a complex disease called leishmaniasis [2]. Leishmania genus comprise 30 species, including 20 species able to cause disease with different clinical manifestations in humans, ranging from asymptomatic, cutaneous and mucocutaneous lesions, to the severe visceral form.

Visceral leishmaniasis is a neglected tropical disease with an estimated 200.000-400.000 new cases and 20.000-40.000 [3] deaths annually, and it is thus a serious public health problem [4]. VL is caused by the protozoan parasites Leishmania (L.) donovani, in India, Bangladesh, Nepal and Pakistan; L. (L.) infantum, responsible for zoonotic leishmaniasis in the Europe and Africa; and L. (L.) infantum chagasi, which shows high genetic similarity with L. (L.) infantum, and has been correlated with zoonotic leishmaniasis in different countries of the Americas (New World) [5-7].

In the New World, Brazil is the country that accounts for the highest number (90%) of visceral leishmaniasis cases, which are distributed through five regions, in 21 States. Based on data of the World Health Organization (WHO), approximately 4200 to 6300 new cases are reported per year [4,8,9]. The expansion of visceral leishmaniasis in Latin America, including Brazil, follow the dispersion of Lutzomya longipalpis, its major vector, which is getting adapted to periurban and urban locations [10-12].

Unless treated, visceral leishmaniasis is fatal, and in order to decrease the risks of L. i. chagasi transmission in Brazil, besides the control of the reservoir and vector agents, the strategy of Brazilian Ministry of Health Visceral Leishmaniasis Control Program includes the necessity of an early and accurate diagnosis to improve treatment. Circulation of Trypanosoma cruzi and others Leishmania species in America are important drawbacks for L. i. chagasi diagnosis. Classically, parasite detection is performed by microscopic examination of amastigotes in Giemsa stained white blood cells obtained by bone marrow, lymph node and spleen aspiration, which are painful, invasive and risky procedures, principally in children. Accuracy of this method depends on the tissue examined, the quality of reagents used and the technician identification ability [13]. Serological methods to diagnose L .i. chagasi present several shortcomings including cross reaction with different Leishmania species and also with others American endemic trypanosomiasis [14].

Two other diagnostic methods used, correspond to culture isolation and nucleic acid based detection techniques, such as PCR, directly from biological specimens of patients infected with L. i. chagasi. Culture isolation is the gold standard, however is less sensitive and time consuming when compared to nucleic acid detection. Molecular targets for PCR comprise amplification of gene fragments encoding the small subunit of ribosomal RNA (SSU rDNA) [15], the internal transcribed spacer of ribosomal DNA (ITS) [16,17], sequences corresponding to the kinetoplast (kDNA) [18], the mini-exon [19], the gene encoding the heat shock protein HSP70 [20], etc. However, for identification of the infecting Leishmania species, the obtained PCR products are subjected to post-PCR handling, as nested PCR [21,22], sequencing and detection of size polymorphism by restriction analysis [23-25]. Real time PCR can also be used to held identification of Leishmania specie [26]. Disadvantages of nucleic acid detection techniques encompass its high operational cost, complexity, cross reactivity with other pathogenic agents, such as species of Trypanosoma [27], and necessity for post-PCR analysis. On the other hand, a high sensitivity and specificity can be obtained with a conventional PCR depending on the molecular target employed. Thus, in this work we developed an accurate L. i. chagasi molecular approach based on conventional PCR targeting a highly conserved and specific Leishmania sp single copy chitinase encoding gene, for detection of parasites in bone marrow and peripheral blood from adults and children



Thirty one adults and thirteen children consecutive patients, with clinical signs of visceral leishmaniasis, presented at the hematologyoncology ambulatory of Marilia Hemocenter, from February 2008 to November 2008, were included in this study. Peripheral blood and bone marrow samples were collected for hematologic and parasitological examination. After laboratorial required exams, the remaining human samples that would be discarded, were submitted to DNA extraction. Samples of bone marrow and peripheral blood were obtained from 12 adult patients; bone marrow and peripheral blood were available for 12 and 7 adult patients, respectively. From children, only bone marrow was obtainable. The protocol used is in agreement with the Helsinki Declaration and was approved by the Ethical Committee in Human Research from Marilia Medical School.

Leishmania sp parasites

Leishmania reference species L. (L). Mexicana, L. (L.) donovani, L. (V.) guyanensis, L. (V.) braziliensis, L. (L.) tropica, L. (L.) amazonensis, L. (L.) major, L. hetigi, L. equatoriensis, L. (V.) lainsoni, L. colombiensis, L. (V.) naiffi, L. (V.) shawi, used in the study were obtained from the Reference Laboratory for Leishmania typing of the Research Laboratory of Leishmaniasis of Instituto Oswaldo Cruz, Oswaldo Cruz Foundation, Ministry of Health. Reference Leishmania species were maintained in culture medium M199 or LIT according to the species requirement and exponential growing parasites were used for DNA extraction.

DNA extraction and gene target oligonucleotide design

DNA from human samples and parasites cultures were extracted by employment of DNeasy® Blood and Tissue Kit (QIAGEN®, Valencia, CA, USA) under manufacturer's instructions. Quality of DNA was verified by visualization of a high molecular weight fragment in 1% agarose gel electrophoresis and the amount of DNA was measured by comparing the band intensity with the Low Mass Ladder standard from Invitrogen/Thermo Fischer Scientific, Waltham, Massachusetts, USA.

For the design of oligonucleotides a survey of all sequences (complete and partial) encoding the chitinase enzyme gene from Leishmania species available in databases, L. donovani (AF009354.1, AY518255.1,
AY518247.1, AY518245.1, AY518243.1, AY518241.1, AY518239.1,
AY518237.1, AY518235.1, AY518233.1, AY518231.1, AY518232.1,
AY518256.1, AY518254.1, AY518252.1, AY518246.1 ,AY518244.1,
AY518242.1, AY518240.1, AY518238.1, AY518236.1, AY518234.1,
AY518248.1), L. major (XM_001682106.1, AY518229.1, AY518227.1,
AY518225.1, AY518228.1, AY518226.1, AY518224.1), L. infantum (XM_001464530.1, AY518250.1, AY518251.1, AY518249.1), L. tropica (AY518230.1, AY518258.1), L. mexicana (AY572789.1), L. braziliensis (XM_001563632.1), and L. amazonensis (XM_001682106.1), were subjected to multiple alignments by the Clustal X program v.2.1 [28,29]. To obtain a graphical representation of the patterns present in the alignment, and to display more accurate description of sequence similarity, the online free available program WebLogo 3 was employed [30]. Thus, considering the conserved regions in the same Leishmania species and between groups of species with the same clinical presentation, specific oligonucleotides to amplify a L. i. chagasi chitinase encoding a fragment of 999 bp (LCQuitFow 5' GCTGCCTGAGCGCTCTACT 3' and LCQuitRev 5' CTCCCTCGACCCATGTTG 3') were designed after in silico evaluation using the tools: Primer3Plus [31], primer-Blast [32] and MFOLD [33]. The specificity and sensitivity of the designed oligonucleotides were experimentally determined by varying PCR reaction and cycling conditions with the enzyme GoTaq® Hot Start Polymerase (Promega ™, Madison, WI, USA). PCR was standardized using DNA of Trypanosoma cruzi, Homo sapiens, and Leishmania species L. (L). Mexicana, L. (L.) donovani, L. (V.) guyanensis, L. (V.) braziliensis, L. (L.) tropica, L. (L.) amazonensis, L. (L.) major, L. hetigi, L. equatoriensis, L. (V.) lainsoni, L. colombiensis, L. (V.) naiffi, and L. (V.) shawi.

L. I. Chagasi molecular diagnosis on human samples

50-100ng of DNA from human peripheral blood and bone marrow were subjected to L. i. chagasi chitinase 999 bp PCR diagnosis with the enzyme GoTaq® Hot Start Polymerase (Promega ™, Madison, WI, USA), according to standard manufacturer conditions, and one cycle of 94°C 3 minutes, 40 cycles of 94°C 1 minute, 62°C 30 seconds, and 72°C 45 seconds, final extension of 72°C 7 minutes.

As control of human genomic DNA quality, a pair of oligonucleotides designed to amplify a 438 pb fragment encoding the first exon of human β-globin gene (−globinFow, 5 'ATGGTGCATCTGACTCCT 3', and β-globinRev 5' GTTCTCAGGATCCACGTGCAG 3') was used. To compare the sensitivity and specificity of molecular diagnostic using primers corresponding to the L. i. chagasi chitinase encoding gene, all clinical human samples were subjected to molecular diagnosis with oligonucleotides LITS-R and L5.8S, which amplify a 320 pb fragment of the gene encoding the Leishmania species rRNA intergenic region 1 (rDNA ITS-1) [16]. The PCR products stained with Gel Red™ (Biotium®, Hayward, CA, USA), were analyzed by electrophoresis in 1% agarose gel.

The L. i. chagasi chitinase amplicons were purified on GFX™ columns of PCR DNA and Gel Band Purification kits (GE Healthcare, Buckinghamshire, UK), and submitted to sequencing reactions using ABI PRISM ® BigDye™ Terminator-kit (Perkin-Elmer® - Applied Biosystems®, Foster, CA, USA) according to manufacturer's specifications, and resolved in automatic sequencer ABI PRISM®-310 Genetic Analyzer (Perkin-Elmer® - Applied Biosystems®, Foster, CA, USA).


Initially, the specificity and sensitivity of the L. i. chagasi diagnostic method based on the 999 bp PCR fragment corresponding to the chitinase gene were determined on DNA control samples including Homo sapiens, Trypanosoma cruzi, and thirteen Leishmania species as described in material and methods. Maximum PCR accuracy was obtained with 62°C of annealing temperature, and the smallest amount of DNA necessary to detect the parasite corresponded to two specimens of L. infantum, L. i. chagasi, L. donovani or L. tropica. The chitinase diagnostic method enabled distinction of L. i. chagasi from all others Leishmania species circulating in America, and also from T. cruzi. In the Old World, L. donovani, L. tropica and L. infantum can be distinguished from L. major.

After standardization of L.i.chagasi chitinase PCR assay, DNA obtained from bone marrow of 25 adult and 13 children, and 19 peripheral blood samples of adult patients with clinical symptoms of visceral leishmaniasis were subjected to chitinase molecular diagnosis. For comparative studies, the same amount of DNA from these clinical samples were also used in PCR reactions with primers corresponding to a fragment of 320 pb encoding the Leishmania sp ITS-1 rRNA gene under the conditions described by Schonian et al., 2003 [16].

From 13 children bone marrow samples, 10 were Leishmania sp positive by means of both molecular diagnostic tests, with a 100% of concordance to parasitological exam, indicating its high specificity and sensitivity. From 24 bone marrow adult samples, 17 were positive for chitinase PCR while 8 were positive for rDNA ITS-1 PCR; and from 19 peripheral blood samples, 15 were positive for chitinase PCR and 7 were positive for rDNA ITS-1 PCR. PCR results with both target genes were concurrent in peripheral blood and bone marrow clinical samples. The specificity of the chitinase PCR assay was confirmed by sequencing of amplicons obtained from all samples.

Both, chitinase and ITS-1 molecular diagnostic methods presented the same sensitivity in samples obtained from children. In this case, the advantage of the chitinase molecular diagnosis is the direct evidence of L. i. chagasi by PCR product analysis through electrophoresis on agarose gel, without post-PCR amplicon manipulation by sequence or restriction analysis. However, in adult samples, chitinase PCR diagnosis presented a higher sensitivity (approximately 50%) than rDNA ITS-1 PCR diagnosis. From 14 adult clinical samples positive for L. i. chagasi through chitinase PCR diagnosis, five were negative in parasitological exam. All 999 bp chitinase amplicons were sequenced and confirmed the homology to the L. infantum chitinase encoding gene, corroborating the increased sensitivity of the chitinase PCR diagnosis compared to parasitological exam.


In Latin America, the visceral leishmaniasis caused by L. i. chagasi is expanding, causing mortality and morbidity in adult and children populations [34]. Brazil accounts for the majority of cases and early diagnosis is essential to treat the disease and to manage L. i. chagasi dispersion through control of insect vector and canine reservoir [35]. The parasitological and culture methods are the gold standards for diagnosis of visceral leishmaniasis [36,37], presenting high specificity, however a variable sensitivity since distribution of parasites in different tissues is not homogeneous [38].

The most commonly used tests in humans and animals for the diagnosis of visceral leishmaniasis are the serological techniques, with the employment of different antigens, including the most recent described recombinant antigen rk39 [39]. Serological tests of choice include the enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence assay (IFAT) [40], both frequently used in epidemiological surveys [41]. These methods show high sensitivity, nevertheless, there are problems with Leishmania species discrimination and cross reaction with other Trypanosoma species [42]. Also, in immunodeficient individuals, as in HIV and Leishmania sp co-infected patients, sensitivity of the serological test is also compromised [43].

After the development of molecular detection techniques in the 80's decade, PCR is being used for the diagnosis of infectious agents, including leishmaniasis [44]. Depending on the gene target selected for amplification, the number of genomic encoding target copies, PCR can be a fast, sensitive and specific method applied to a variety of clinical samples [45]. There are several nucleic acid detection methods described to diagnose L. i. chagasi on clinical samples of human and dogs [46]. Although PCR shows high specificity and sensitivity, it is best used in epidemiological studies than as a routine diagnostic method because it is complex and the operational cost is still high to be used on a large scale, due to necessity of post-PCR manipulation to distinguish the Leishmania infecting specie [47-49]. Furthermore, PCR has been widely used to study the function of many genes, establish the parasite/ host relationship and to investigate possible chemotherapy targets [38].

In this scenario, in this work we described an accurate L. i. chagasi PCR diagnosis based on the use of the single copy and highly conserved species-specific chitinase encoding gene [50]. Comparative investigation showed a higher sensitivity of the chitinase molecular method than the PCR diagnosis founded on the multiple copy gene encoding the rDNA ITS-1. Probably, the Leishmania sp chitinase encoding gene is located in a most accessible genomic topological region, with less possibility of secondary structure formation during the PCR reaction, when compared to the rDNA locus. Also, due to the Leishmania sp chitinase encoding gene specificity, detection of L. i. chagasi presented high accuracy and absence of cross reaction with others Leishmania species and T. cruzi.

Accordingly, the chitinase conventional PCR approach described here could be used in routine American visceral leishmaniasis diagnosis in bone marrow and peripheral blood clinical samples, being particularly useful to immunocompromised patients and children.


This work was supported by Fundação de Amparo a Pesquisa do Estado de São Paulo (M.A.S, grant number 2012/20221-9), (ADC, felowship 2013/26096-4), (C.O.C.C.S., fellowship number 2012/22732-0), (A.M., grant number 2010/50886-7 and fellowship).


Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8082
  • [From(publication date):
    January-2016 - Jan 24, 2018]
  • Breakdown by view type
  • HTML page views : 8000
  • PDF downloads : 82

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals


[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version