alexa A Multiplex-Urease PCR Assay for Detection of Helicobacter pylori Infection Directly from Gastric Biopsy Specimens and Comparison of Multiplex- Urease PCR Results with Rapid Urease Test and Histopathology
ISSN: 2327-5073
Clinical Microbiology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

A Multiplex-Urease PCR Assay for Detection of Helicobacter pylori Infection Directly from Gastric Biopsy Specimens and Comparison of Multiplex- Urease PCR Results with Rapid Urease Test and Histopathology

Sinem Oktem-Okullu1, Arzu Tiftikçi2, Murat Saruc2, Bahattin Cicek2, Eser Vardareli2, Nurdan Tozun2, Tanıl Kocagöz1, Ugur Sezerman4, Ahmet-Sinan Yavuz5 and Ayca Sayi-Yazgan3*

1Department of Medical Microbiology, School of Medicine, Acıbadem University, Istanbul, Turkey

2Department of Internal Medicine, School of Medicine, Acıbadem University, Istanbul, Turkey

3Department of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey

4Department of Biostatistics and Medical Informatics, School of Medicine, Acıbadem University, Istanbul, Turkey

5Molecular Biology, Genetics and Bioengineering Program, Faculty of Engineering and Natural Sciences, Sabancı University, Tuzla, Istanbul, Turkey

*Corresponding Author:
Ayca Sayi-Yazgan
Department of Molecular Biology and Genetics
Istanbul Technical University, Istanbul, Turkey
Tel: +9005325844485
Email: [email protected]

Received date: April 6, 2017; Accepted date: April 27, 2017; Published date: April 30, 2017

Citation: Okullu SO, Kocagöz T, Tiftikçi A, Yazgan AS, Tozun N, et al. (2017) A Multiplex-Urease PCR Assay for Detection of Helicobacter pylori Infection Directly from Gastric Biopsy Specimens and Comparison of Multiplex-Urease PCR Results with Rapid Urease Test and Histopathology. Clin Microbiol 6:279. doi:10.4172/2327-5073.1000279

Copyright: © 2017 Okullu SO, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Clinical Microbiology: Open Access

Abstract

Purpose: To develop a multiplex-urease PCR assay specific for ureA and ureB genes directly from gastric biopsy specimens and compare the results of multiplex-urease PCR assay with rapid urease test (RUT) and histopathology.

Methodology: This study was conducted on 109 patients. A RUT was run; histopathological staining and multiplex urease PCR were applied to biopsy specimen to detect H. pylori. Multiplex-urease PCR, RUT and histopathology results were compared by calculating Cohen’s kappa coefficient.

Results: A multiplex-urease PCR assay specific for ureA and ureB genes was developed to detect H. pylori directly from biopsy specimens. Cohen's kappa coefficient results of histopathological staining and multiplex-urease PCR indicate a substantial agreement. There was a moderate agreement between the results of histopathological staining and RUT results. There is a fair agreement between the multiplex urease PCR and the RUT results. Furthermore, the multiplex-urease PCR can detect H. pylori in some samples that are identified as negative by the rapid urease test and histopathological staining method. Moreover, in some patient samples ureA could not be detected while ureB detected.

Conclusion: Multiplex-urease PCR assay was developed to detect ureA and ureB genes of H. pylori directly from gastric biopsy specimens. Comparison results indicated that detection rate of H. pylori with multiplex-urease PCR and histopathological staining is higher than the RUT. Moreover, it is critical to apply RUT test to biopsy specimens taken from both antrum and corpus part as in multiplex urease PCR assay. Furthermore, developing a multiplex PCR for both ureA and ureB is essential to detect active H. pylori infection.

Keywords

H. pylori ; Urease A and B; Multiplex-PCR; RUT; Histopathology

Background

Helicobacter pylori (H. pylori ) is a Gram negative, spiral-shaped, microaerophilic bacterium that is colonized primarily in the stomach of more than half of the world’s population during their life span. While most of the infected individuals remain asymptomatic, bacteria have a significant pathogenic role in peptic ulcer, chronic gastritis, mucosa-associated lymphoid tissue lymphoma and gastric cancer in 20% of infected individuals [1].

There are both invasive and non-invasive diagnostic tests for H. pylori infection. Invasive tests require upper gastrointestinal endoscopy (gastroscopy) and are based on the analysis of gastric biopsy samples. Non-invasive techniques such as serology, urea breath test (RUT), urine/blood test, or detection of H. pylori antigen in stool specimen [2].

Rapid urease test (RUT) is a widely used in clinical practice as a biopsy-based method, to detect H. pylori urease enzyme which promotes the survival of bacteria in the acidic stomach environment breaking down the urea into carbon dioxide and ammonia allowing H. pylori to survive in the acidic medium. RUT method detects the active H. pylori infection in a gastric biopsy specimen using an agar gel or a reaction strip containing urea. A biopsy specimen is taken from the antrum of the stomach is placed into a medium containing urea and an indicator such as phenol red. The urease produced by H. pylori hydrolyzes urea to ammonia, which raises the pH of the medium, and changes the color of the specimen from yellow (negative) to red (positive). It is a simple and a rapid test but its sensitivity and specificity can be decreased in patients with acute ulcer bleeding and usage of bismuth containing compounds and antibiotics [3].

Urease enzyme is pivotal for decreasing stomach acidity by generating ammonia and carbonate from urea. Urease enzyme is necessary for H. pylori colonization on the gastric mucosa layer and a potent immunogenic that elongates a vigorous immune response. The active site of the urease enzyme is found in the UreB subunit. The UreA subunit of Helicobacter species is different from the other bacterial species because of its amino acid sequence that is encoded by the single ureA gene [4].

For the genetic identification of H. pylori several PCR assay methods have been developed [5]. In a study vacA and cagA were investigated by multiplex PCR in directly from gastric biopsy specimens, for genotyping [6]. In another study H. pylori was detected by using one step multiplex PCR targeted to urease A gene, 16S ribosomal RNA and hpaA gene [7]. To best of our knowledge there are no multiplex PCR assay for ureA and ureB for the detection of H. pylori previously published.

The aim of the present study was to develop a multiplex-urease PCR assay specific for ureA and ureB directly from gastric biopsy specimens and compare the results with rapid urease test (RUT) and histopathology results to determine its sensitivity and specificity.

Methods

Ethical approval

Each patient included in this study provided a written informed consent to participate to the study. This study was approved by the ethical committee of the Acıbadem University and Istanbul Technical University.

Patients selection

Biopsy specimens were obtained from the patients who underwent endoscopy because of gastroduodenal diseases at the Gastroenterology Department of Acibadem Hospital Groups, in Istanbul, Turkey. In total, 109 patients were selected for the study.

Gastric biopsy specimens

During endoscopy two gastric biopsy specimens were taken from the antrum and corpus parts of stomach for the DNA isolation. Fresh biopsy specimens were placed into the RNA later solution (Ambion, RNAlater® RNA Stabilization Solution) and kept at +4°C for overnight then put at –80°C deep freezer until DNA isolation. Also biopsy specimens were obtained for the routine RUT and histopathological examination.

DNA extraction

To study multiplex urease PCR, DNA was extracted by using a DNA isolation kit (Quick g-DNATM, ZYMO RESEARCH) following the manufacturer’s description. All DNA samples were quantified using NanoDrop (ND-2000, ROCHE) and maintained in –80°C deep freezer.

Primer design

Primers, obtained from metabion international AG, Germany, were used in this study. For the multiplex urease PCR assay primers, GenBank entries were searched for the selected urease genes sequences including ureA, ureB. The primers were designed by using Primer 3 software (Table 1). A BLAST search was performed to confirm the specificity of the DNA sequences of all the primers (http:// www.ncbi.nlm.nih.gov/BLAST/).

DNA region(s) amplified Primer Name Sequence (5'→3') PCR Product Size (bp)
ureA ureA-F TGATGGGACCAACTCGTAACCGT 244
ureA ureA-F CGCAATGTCTAAGCGTTTGCCGAA 244
ureB ureB-F AGTAGCCCGGTAGAACACAACATCCT 645
ureB ureB-F ATGCCTTTGTCATAAGCCGCTTGG 645

Table 1: Multiplex urease PCR primers designed for the amplification of H. pylori urease genes.

Multiplex urease PCR assay

For rapid identification of H. pylori with urease (urea) gene-based PCR assay, genomic DNA from several biopsy specimens and primer sequences were evaluated. ureA and ureB genes are the targets for the urease activity of H. pylori . To optimize the multiplex urease PCR genomic DNA isolated from H. pylori G27 strain was used as a positive control that includes both ureA and ureB genes. The amplification reactions were carried out in a total volume of 25 μl and the multiplex urease PCR assay mixture consisted of 0.65 U of Dream Taq DNA polymerase (Thermo Scientific), 2.5 μl from 10X Dream Taq Buffer (includes 20 mM MgCl2), 20 μM of forward and reverse primers, 200 μM of each dNTP and 3 μl DNA. Amplification programme included an initial denaturation step at 95°C for 3 min followed by 45 cycles of denaturation at 95°C for 45s, primer annealing at 60°C for 45s and primer extension at 72°C for 2 mins, with final extension step at 72°C for 5 mins.

The PCR products were subjected to electrophoresis on agarose gels and stained with SYBR Gold (In vitro gene). The specificity of the urease primer pairs was confirmed by employing a positive and several negative controls.

Results

Detection of H. pylori by multiplex urease PCR

Two subunit genes, ureA and ureB encode urease, which is the enzyme that contributes to the survival of bacteria in the acidic environment of the stomach. To determine the presence of H. pylori in human gastric biopsy specimens, we assessed the expression status of ureA and ureB by multiplex-PCR assay. We utilized H. pylori strain G27 with a known complete genome sequence [8] to optimize multiplex-PCR to detect H. pylori virulence factor genes, ureA and ureB genes. As a result of optimization studies, ureA and ureB genes were detected in a single PCR assay (Figure 1).

clinical-microbiology-negative-samples

Figure 1: Multiplex urease-PCR assay to detect the H. pylori positive and negative samples; Lane M: 100 bp ladder-marker (ThermoSCIENTIFIC, Gene Ruler); Lane 1: amplification of ureA and ureB genes of H. pylori positive control strain G27; between Lane 2 to 5 are from randomly selected patients. Lane 2 is H. pylori positive patient sample. Lane 3 to 5 are H. pylori negative samples.

Next, we used multiplex-urease PCR assay to detect the presence of H. pylori in gastric biopsy specimens of 109 patients. In total 80 of these patients were detected as H. pylori positive.

Furthermore, multiplex-urease PCR results were compared with methods used in routine, the rapid urease test and histopathological staining. To analyses the efficiency, specificity and accuracy of multiplex-urease PCR assay compared with the rapid urease test and histopathological staining, Cohen's kappa coefficient value which measures inter-rater agreement for categorical items, was calculated for each comparison (Figure 2). If the raters are in complete agreement then κ=1. The κ value can be interpreted as follows; κ<0 “poor agreement’’, κ=0.00-0.20 “slight agreement”, κ=0.21-0.40 “fair agreement”, κ=0.41-0.60 “moderate agreement”, κ=0.61-0.80 “substantial agreement”, κ=0.81-1.00 “almost perfect agreement’’ [9]. There was a substantial agreement between the results of multiplexurease PCR and the histopathological staining. Cohen's kappa coefficient for the comparison of histopathological staining and rapid urease test results indicate a moderate agreement. There is a fair agreement between the multiplex urease PCR and the rapid urease test results in which the κ is between 0.21-0.40 (Figure 2). Furthermore, the multiplex-urease PCR can detect H. pylori in some samples that are identified as H. pylori negative by the rapid urease test and histopathological staining method.

clinical-microbiology-multiplex-urease

Figure 2: Comparison of multiplex urease PCR test results with the rapid urease test and histopathological staining. For each comparison Cohen’s kappa coefficient was used for calculation.

Discussion

There are many different tests available to identify H. pylori , each of which has certain advantages and disadvantages. However, due to poor sensitivity or specificity, none of them can be considered as gold standard. Rapid urease test and pathological staining are the most useful methods in the clinical practice to detect H. pylori [10]. In this study, multiplex urease PCR assay was developed to detect ureA and ureB virulence genes of H. pylori . Comparison of the results of the rapid urease test with histopathological staining and the multiplex urease PCR indicated that detection rate of H. pylori with multiplex urease PCR and histopathological staining is higher than the rapid urease test. The possible reason for the lack of sensitivity of rapid urease test might be the region of biopsy specimens that is taken to be only from the antrum part of the stomach where the most of the bacterial colonization can be seen. However, localization of H. pylori colonies in patients can vary as being only in antrum, only in corpus or in both antrum and the corpus part of the stomach. In the multiplex urease PCR and histopathological staining method two biopsy specimens, one from antrum and one from corpus part of stomach are taken to increase the detection rate of H. pylori . Additionally, we identified that sensitivity of multiplex urease PCR assay was higher than the histopathological staining in this study. The reason for this may be because PCR may detect the DNA of the bacteria that has just began to colonize and the histopathological staining may not detect these newly colonized bacteria. Using the combinations of rapid urease test, histopathological staining and multiplex urease PCR assay, may provide quite satisfactory results in the diagnosis of H. pylori infection. Moreover, one-step multiplex-urease-PCR molecular technology acts as a diagnostic safety net in the detection of H. pylori .

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 553
  • [From(publication date):
    April-2017 - Dec 14, 2017]
  • Breakdown by view type
  • HTML page views : 488
  • PDF downloads : 65
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version