alexa
Reach Us +1-947-333-4405
A Pilot Study of MicroRNA Expression Profiles of Spinal Neuron in Matrix Metalloproteinase-9 Knockout Mice
ISSN: 2161-0681

Journal of Clinical & Experimental Pathology
Open Access

Like us on:

OMICS International organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.

Open Access Journals gaining more Readers and Citations
700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers

This Readership is 10 times more when compared to other Subscription Journals (Source: Google Analytics)
All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.
  • Research Article   
  • J Clin Exp Pathol, Vol 9(2): 367

A Pilot Study of MicroRNA Expression Profiles of Spinal Neuron in Matrix Metalloproteinase-9 Knockout Mice

Jianpeng Li1,2, Bin Jiang1,2, Yidan Zhang1, Ran Yao3, Shijie Duan3, Yikang Wang3, Suijun Tong1,2* and Min Bi1,2*
1Department of Neurology, The First Affiliated Hospital of Xiamen University, Xiamen 361003, Fujian, China
2The First Clinical Medical College of Fujian Medical University, Fuzhou 350005, Fujian, China
3Medical College of Xiamen University, Xiangan Road, Xiamen 361102, Fujian, China
*Corresponding Author(s): Suijun Tong, Department of Neurology, The First Affiliated Hospital of Xiamen University, 55 Zhenhai Road Xiamen, 361003, Fujian, China, Email: [email protected]
Min Bi, The First Clinical Medical College of Fujian Medical University, 20 Chazhong Road, Fuzhou 350005, Fujian, China, Tel: 8615010712956, Email: [email protected]

Received Date: Apr 12, 2019 / Accepted Date: Apr 26, 2019 / Published Date: Apr 30, 2019

Abstract

Matrix metalloproteinase-9 (MMP9) plays a key role in blood-spinal cord barrier dysfunction. MMP9 blockade leads to improved injured locomotor recovery. However, it is still unknown whether MMP9 deficiency affects gene expression or signal transduction pathways in spinal neuron. In this study, we firstly screen the MMP9 knockdown mice with high SOD expression and low MMP9 expression by polymerase chain reaction (PCR) analysis. Then the gene microarrays were used to screen differentially expressed genes in spinal neuron from MMP9 knockout and wild-type mice. There were six groups in this experiment, including 3 negative control groups: SOD_1, SOD_2 and SOD_3, and 3 experiment groups: SOD_ MMP9_1, SOD_ MMP9_2, and SOD_ MMP9_3. The GO (Gene Ontology) terms was used to predict the potential functions of these differentially expressed genes and KEGG (Kyoto Encyclopaedia of Genes and Genomes) was used to analyse the potential functions of these target genes in the pathways. We found that the gene expression in the spinal neuron from MMP9 knockout mice was significantly altered compared to wild-type mice. In summary, MMP9 play a role in spinal neuron signalling and the underlying mechanism may through affecting several signalling pathway, including FoxO signalling, Axon guidance, Ubiquitin mediated proteolysis, regulation of actin cytoskeleton and Proteoglycans.

Keywords: Matrix metalloproteinase-9; Spinal neuron; Microarray analysis; Differentially expressed genes

Keywords

Matrix metalloproteinase-9; Spinal neuron; Microarray analysis; Differentially expressed genes

Introduction

With an increasing number of traffic accidents, spinal cord injury becomes a serious common clinical disease with high morbidity. The tight junctions of capillaries, basement membrane and blood-brain barrier were then destructed by MMP9 [1]. After that the vasogenic edema in central nervous system is appearing. Under the normal circumstances, MMP9 is expressed in microglia, astrocytes, and hippocampal neurons at a low constitutive level. Moreover, it can be induced in astrocytes, microglia/macrophages, and hippocampal cells in the central nervous system [2-5]. However, MMP9 increased rapidly in both inflammatory cells and endothelial cells after the spinal cord injury and reached a maximum at 24 hr. It may be associated with the abnormal vascular permeability caused by hemorrhagic injury or inflammation [6,7]. In the past few years, Matrix metalloproteinase-9 (MMP9) was confirmed to play a key role in blood-spinal cord barrier dysfunction [8]. MMP9 blockade leads to improved injured locomotor recovery. The above studies provided insight concerning the effect of MMP9 in spinal neuron. In this study, in order to detect the effect of MMP9 on gene expression and signal transduction pathways in spinal neuron, we chose the mice model with MMP9 knockdown. We first screen the MMP9 knockdown mice in the offspring. The polymerase chain reaction (PCR) analysis was performed on the tail genomic DNA and the mice with high SOD expression and low MMP9 expression was chosen as the experiment groups. In order to identify whether gene expression would be affected by MMP9 deletion, in this study, we used spinal neuron from MMP9 knockout and wild-type mice, screened for differentially expressed genes using microarrays. The GO (Gene Ontology) terms was used to predict the potential functions of these differentially expressed genes and KEGG (Kyoto Encyclopaedia of Genes and Genomes) was used to analyse the potential functions of these target genes in the pathways. Our results showed that the gene expression in the spinal neuron from MMP9 knockout mice was significantly altered and we predicted that MMP9 play an important role through affecting several signalling pathway, including FoxO signalling, Axon guidance, Ubiquitin mediated proteolysis, regulation of actin cytoskeleton and Proteoglycans.

Materials and Methods

Ethics approval and informed consent

All animals were obtained from The First Affiliated Hospital of Xiamen University (Fujian, China) and all experiments were approved by the Institutional Animal Care and performed in accordance with the Guidance Suggestions for the Care and Use of Laboratory Animals.

Preparation of EGE-LZX-010 knockout mice

EGE-LZX-010 gene is located on the positive strand of chromosome 2, with a total length of about 15.1 KB (NCBI ID: 17395). EGELZX- 010 knockout mice were prepared by using CRISPR/Cas9 (Beijing Biocytogen Co., Ltd). By analysing the structure of EGELZX- 010 gene, two sgRNAs were used to knock out exon1-12 of EGELZX- 010 genes. In order to ensure the efficiency of the designed Cas9/sgRNA, the target sequences of C57BL/6 mouse tails were amplified by PCR and verified by sequencing, and the primers were shown in Figure 1A. Based on the design principle of sgRNA, a total of 14 sgRNA were designed, and the corresponding oligo sequences were shown in Figure 1B. And then the Cas9/sgRNA plasmid was constructed, meanwhile, the activity of sgRNA was detected by UCATM. Finally, Cas9-sgRNA was injected embryos to construct the EGE-LZX-010 knockout mice. The injected embryos then developed into F0 generation mice, and the genotype of F0 generation mice was measured by PCR, the primers were shown in Figure 1C. F0 generation positive mice were mated with wild type to obtain F1 generation mice with stable genotype, and the genotype of F1 generation mice was also measured by PCR.

clinical-experimental-pathology-oligo-sequences

Figure 1: The sequences of primers in this study; (A) The primers to detect the target sequences (B) The oligo sequences of 14 sgRNAs (C) The primers to detect the genotype of mice.

Sampling and DNA purification

Mouse genotypes were verified throughout the study by polymerase chain reaction (PCR) performed on tail genomic DNA. Firstly, 0.5-1 cm tissue from the tail of mice of each group was ground into powder by using liquid nitrogen. The DNA was extracted from each sample using DNA extraction Kit (Generay, GK0121) according to manufacturer ’ s instructions. The concentration of DNA was determined by measuring the absorbance of each sample at A260/280 using Merinton SMA 4000. The DNA with the ratio of A260/A280 between 1.8~2.2 was kept for the following PCR analysis. Extracted DNA was stored in a freezer at 4°C or 20°C.

PCR procedures

2 pair of oligonucleotide primers were used to perform the PCR procedures: EGE-LZX-010-5, MSDF: EGELZX0103,MSDR: 5'TGGGGGTCCTGCCTGACTTG3', 5'CAGTCAGAACCTCTGCCCTCCTC3',SODF: 5'CAGTCAGAACCTCTGCCCTCCTC3' and SOD-R: 5'CGC GAC TAA CAA TCA AAG TGA3'. PCR were performed in a 96-well using a GeneAmp PCR kit (Applied Biosys-tems, Foster City. CA) in a-25 μL total reaction volumes containing 2.5 μL of PCR buffer 10x (50 mM KCl, 10 mM Tris-HCl [pH=8.3], 0.1% Triton X-100), 1.0 μL genomic DNA, 1 μL of each primer, 2 μL dNTPs and 0.5 μL10U/μLof Taq DNA polymerase (TaKaRa). GeneAmp PCR System 9700 was used to analyze the result.

Target genes prediction, GO enrichment and KEGG pathway analysis

Differentially expressed miRNAs were screened with p-value less than 0.05 and the potential target genes were predicted by using TargetScan and MiRanda online software. The intersection elements of the two software were accepted as candidate target genes of the differential miRNA. The Hierarchical Clustering (HCL) was performed to determine the normalized expression level of each RNA type. The predicted target genes were input into the Gene Ontology Database (http://www.geneontology.org/) to execute GO annotation and enrichment analysis from three ontologies: Molecular function, cellular component and biological process. The GO terms were significantly enriched in the predicted target gene candidates of the miRNA compared with the entire gene background. The GO terms with the p-values ≤ 0.01 are defined as significantly enriched in the target gene candidates. Furthermore, KEGG (Kyoto Encyclopaedia of Genes and Genomes) database (http://www.genome.ad.jp/kegg/) was used to analyse the potential functions of these target genes in the pathways. The genes with p ≤ 0.5 were considered significantly enriched in target gene candidates.

Statistical analysis

The data was presented as the mean ± standard deviation (mean ± SD) and analyzed by the Student's t-test and variance (ANOVA) using SPSS 15.0 software (SPSS, Chicago, IL, USA). p<0.05 was considered statistically significant.

Results

Preparation and identification of EGE-LZX-010 knockout mice

To prepare the EGE-LZX-010 knockout mice by CRISPR/Cas9 (Beijing Biocytogen Co., Ltd), the activities of 14 sgRNA were detected, and the results were shown in Figure 2A. Meanwhile, EGE-LZX-010- sgRNA5 and EGE-LZX-010-sgRNA9 were ligated into the T7 promoter plasmid to obtain microinjected RNA. The microinjected RNAs were identified by PCR assay and the results were shown in Figure 2B. In addition, the EGE-LZX-010 knockout mice were obtained by injecting Cas9-sgRNA into embryos. The genotype of F0 generation mice were identified by PCR assay and the results indicated that EX10-1, EX10-4, EX10-6, EX10-7, EX10-12 and EX10-14 were the positive mice (Figure 3A). And then the F1 generation mice were obtained by F0 generation positive mice mated with wild type (Figure 3B). The genotype of F1 generation mice were also identified by PCR assay, and the results indicated that 1EX10-9, 1EX10-10, 1EX10-11, 1EX10-13, 1EX10-14, 1EX10-18, 1EX10-19, 1EX10-20, 1EX10-21, 1EX10-22, 1EX10-23, 1EX10-27 and 1EX10-28 were positive heterozygous mice (Figure 3C).

clinical-experimental-pathology-microinjected

Figure 2: The activity identification of Cas9/sgRNA; (A) Cas9/ sgRNA activity was measured by -UCATM (B) The microinjected RNAs were detected by PCR assay.

clinical-experimental-pathology-mice-genotype

Figure 3: Detection of mice genotype; (A) The genotype of F0 generation mice was measured by PCR assay (B) F0 generation positive mice were mated with wild type (C) The genotype of F1 generation mice was measured by PCR assay.

Genotype

We detected the gene MMP9 and SOD expression in the progeny of MMP9 knockout mice by polymerase chain reaction (PCR) performed on tail genomic DNA and screen mice with high SOD expression and low MMP9 expression. Using a primer pair spanning a sequence of MMP9 gene (EGE-LZX-010) that was knocked out in mice, a 236-bp fragment was generated but the 600-bp fragment was not in line 21 and line 22 (Figure 4). The experiment was repeated 6 times and the results were available in Figure S1.

clinical-experimental-pathology-polymerase-chain

Figure 4: Screening mice with high SOD expression and low MMP9 expression by polymerase chain reaction (PCR) analysis. MMP9 and SOD expressions in the progeny of MMP9 knockout mice were assessed by PCR assay with mouse tail genomic DNA and a specific primer pair designed from the MMP9 gene sequence (EGELZX- 010). The PCR products were analyzed by 1.5% agarose gel electrophoresis.

Differentially expressed genes in spinal neuron of MMP9 knockout mice

In the resent study, a total of 58589 genes were annotated. A dendrogram of a hierarchical clustering analysis of differentially expressed miRNAs between the SOD mice with and without MMP9 knockout. The different expression of mouse miRNAs at the probe level was showed in the heatmap. The expression profiles of 215 mature miRNAs were assessed using miRNA microarrays in SOD mice in the control groups and MMP9 knockout groups. Among these, 20 miRNAs were differential expression (17 down-regulated and 3 upregulated) in PMM9 knockout group compared to control group (Figure 5). Differentially expressed miRNA target gene prediction is listed in Table 1.

clinical-experimental-pathology-hierarchical-clustering

Figure 5: A hierarchical clustering analysis of differentially expressed miRNAs between the SOD-expressed mice with and without MMP9 knockout. The heatmap showed the expression levels of differentially expressed mouse miRNAs. Heatmap colors represented the relative miRNA expression levels as indicated in the color key. The different color indicated different miRNA expression levels. Red indicates the high expression of miRNA and green indicates the low expression of miRNA.

Index Reporter Name Target Sequence (5' to 3')
1 mmu-miR-6239 UAGCGUUGGAUCACUCGGUG
2 mmu-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
3 mmu-miR-99b-5p CACCCGUAGAACCGACCUUGCG
4 mmu-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
5 mmu-miR-2137 GCCGGCGGGAGCCCCAGGGAG
6 mmu-miR-92a-3p UAUUGCACUUGUCCCGGCCUG
7 mmu-miR-6348 UCAGCCUUUAUAAGGUGUGUGU
8 mmu-miR-5121 AGCUUGUGAUGAGACAUCUCC
9 mmu-miR-130a-3p CAGUGCAAUGUUAAAAGGGCAU
10 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
11 mmu-miR-140-3p UACCACAGGGUAGAACCACGG
12 mmu-miR-15b-5p UAGCAGCACAUCAUGGUUUACA
13 mmu-miR-342-3p UCUCACACAGAAAUCGCACCCGU
14 mmu-miR-145b GUCCAGUUUUCCCAGGAGACU
15 mmu-miR-30b-5p UGUAAACAUCCUACACUCAGCU
16 mmu-miR-30c-5p UGUAAACAUCCUACACUCUCAGC
17 mmu-miR-2861 GGGGCCUGGCGGCGGGCGG
18 mmu-miR-30d-5p UGUAAACAUCCCCGACUGGAAG
19 mmu-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
20 mmu-miR-6981-5p GUGAGGAGAAGGAAGAGGCUGAAGGC
21 mmu-miR-7056-5p UGUGGAGGAGGACAGAGAGGUU

Table 1: Differentially expressed miRNA target gene prediction (Partial, p ≤ 0.05).

GO annotations analysis of candidate target genes

To understand more about the roles of differentially expressed miRNAs between SOD and SOD_MMP9 group ’ s mice, the differentially expressed genes were assigned to 565031 GO terms, including biological processes, cellular components and molecular function terms. 21754 putative target genes targeted by 13407 differentially expressed miRNAs were selected and submitted to Gene Ontology (GO) enrichment. Among all Go terms, the biggest is GO: 0005737, annotated for 5699 candidate target genes. All candidate target genes were distributed into 1188 Go terms. Typical enriched GO terms are shown in Figure 6A. We can see that the most enriched biological process term is “regulation of transcription”, “transcription, DNA-template ” and “ transport ” . The most enriched cellular component term is “membrane”, “integral component of membrane”, and “ cytoplasm” . The most enriched molecular function term is “protein binding”, “metal ion binding” and “nucleotide biding”. The statistics of the enriched GO categories for the target genes of differentially expressed miRNAs are shown in Figure 6B. We can see the most of the genes were located in the membrane and nucleus, related to transport, binding activity, transcription, and transferase activity and other biological functions.

clinical-experimental-pathology-pathway-enrichment

Figure 6: The statistics of GO pathway enrichment. (A) The percent of genes in GO term was shown in the Bar chart of biological processes, cellular components and molecular functions (B) Scatterplot of enriched terms showed the statistics of GO enrichment in spinal neuron of MMP9 knockout mice. The circular dots represented the numbers of annotated genes for different GO terms. Different colours represented different levels of significance (p-value). The rich factor was a ratio of the gene numbers of each term to the numbers of all genes with terms.

KEGG pathways analysis of candidate target genes

KEGG database is a collection of various pathways, representing the molecular interactions and reaction networks. To identify signalling pathways involved in Spinal neuron of MMP9 knockdown mice, 42459 differentially expressed genes were submitted to Kyoto Encyclopaedia of Genes and Genomes (KEGG) analysis. We found that the differentially expressed genes were significantly enriched in 124 KEGG pathways. The top 20 enriched pathways are shown in Figure 7. Differentially expressed genes were highly clustered in several signalling pathways, such as ‘‘FoxO signalling” “Axon guidance”, “Ubiquitin mediated proteolysis”, “regulation of actin cytoskeleton” and “Proteoglycans in cancer”, suggesting that MMP9 may perform its function through these pathways.

clinical-experimental-pathology-Rich-factor

Figure 7: The selected top enriched pathway terms. Scatterplot of enriched KEGG pathway showed the top 20 pathways enriched in spinal neuron of MMP9 knockout mice. Rich factor was the ratio of the differentially expressed gene number to the total gene number in a certain pathway. The colour and size of the dots represented the range of the p-value and the number of genes to the indicated pathways, respectively. Top 20 enriched pathways were shown in the figure.

Discussion

The neurodegenerative disease is a kind of disease characterized by neuronal loss, neuronal dysfunction, and cell death [9]. For example, most motor neurons die in the progress of amyotrophic lateral sclerosis (ALS). Superoxide dismutase (SOD) is a ubiquitously expressed cytosolic metalloenzyme which is closely related to the progressive motor neuron death and is implicated in inherited amyotrophic lateral sclerosis (ALS) [10]. Kaplan et al. have confirmed that the increment of superoxide dismutase (SOD) and reduction of MMP9 function significantly delayed muscle denervation. And they suggested that MMP9 may be a candidate therapeutic target for ALS [11]. In this study, we chose the mice with high SOD expression and low MMP9 expression in the offspring of MMP9 knockdown mice with the polymerase chain reaction (PCR) analysis. As shown in Figure 1, a 236-bp fragment was generated but the 600-bp fragment was not in line 21 and line 22.

MMP9 is expressed normally in neurons, astrocytes, oligodendrocytes, microglia cells [12-14], while MMP9 can additionally be found in inflammatory cells such as macrophages, lymphocytes, neutrophils and endothelial cells after spinal cord injury [15-18]. The MMP9 activation leads to the degradation of type IV collagenase and destruction of the extracellular matrix. As a result, the increase in microvascular basement membrane permeability, structural changes, blood-brain barrier or blood spinal cord barrier damage, edema, and hemorrhage following one by one [19-21]. The study performed by Noble et al. showed that MMP9 played an important role in wound remodelling, cell migration, and neurite outgrowth after spinal cord injury [13]. The significantly upregulated expression of MMP9 is correlated with the dysfunction in blood-spinal barrier integrity and inflammation. In order to support the pathogenic role for MMP9 in SCI, MMP9 null mice were used to the experiment and the result showed that a marked improvement in functional recovery in MMP9 null mice compared to wild-type controls [13]. The inhibition of MMP9 activity improves recovery, highlighting the beneficial roles of MMP9 following SCI [22]. However, it is still unknown whether MMP9 deficiency affects gene expression or signal transduction pathways in spinal neuron.

In the previous years, it has been realized that the expression of individual genes in an organism is the result of a network of regulatory genes. Whether MMP9 inactivation might lead to changes in the expression of related genes in spinal neuron has not been detected clearly. Because of the characteristics of broad detection range and accuracy, microarrays have been widely used to identify large numbers of differentially expressed genes in organism. Based on the above research, we confirmed that the microarray combined with knockout mice is an effective strategy to research the mechanism of different genes regulation. In the present study, using MMP9 knockout mice and wild-type mice as a comparison, differentially expressed genes in the spinal neuron between MMP9 knockdown and SOD mice were identified using microarrays.

The GO and KEGG analyses were used to analyse the potential functions of these target genes in the pathways. It was found that altered expressions of genes included physiological functions such as ion transport, regulation of transcription, as well as those that regulate corresponding signal transduction pathways, such as different signalling pathways, pathway in cancers, biological and cellular processes. In the previous studies, we know that as a kind of NF-KBregulated genes, MMPs are closely associated with tumor invasion [23,24]. The study performed by Forsyth et al. showed that the MMP9 level was closely related to the increase of tumour progression in gliomas and was known as key enzymes for invasion [25]. Additionally, Lakka et al. suggested that MMP9 was also expressed when tumour cells migrate [26]. The data from the present study indicated that when MMP9 is lost, global gene expression and protein function within the spinal neuron are affected.

Conclusion

In conclusion, the down-regulation of MMP9 affected several signalling pathways in spinal neuron signalling including FoxO signalling, Axon guidance, Ubiquitin mediated proteolysis, regulation of actin cytoskeleton and Proteoglycans and these pathways may be underlying mechanism for MMP9 to function in spinal neuron signalling.

Acknowledgements

This work was financially supported by The Natural Science Foundation of Fujian Province of China (Grant Number: 2015J01547) and the Young and Middle-Aged Key Personnel Training Project of Fujian Province Health System of China (grant number: 2015-ZQNJC- 41).

References

Citation: Li J, Jiang B, Zhang Y, Yao R, Duan S, et al. (2019) A Pilot Study of MicroRNA Expression Profiles of Spinal Neuron in Matrix Metalloproteinase-9 Knockout Mice. J Clin Exp Pathol 9: 367.

Copyright: © 2019 Li J, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Article Usage
  • Total views: 118
  • [From(publication date): 0-0 - Sep 21, 2019]
  • Breakdown by view type
  • HTML page views: 95
  • PDF downloads: 23
Top