alexa Agrobacterium- Mediated Transformation of Tobacco Plants using Walnut Polyphenol Oxidase Gene

ISSN: 2157-7471

Journal of Plant Pathology & Microbiology

Reach Us +44-1993-227344

Agrobacterium- Mediated Transformation of Tobacco Plants using Walnut Polyphenol Oxidase Gene

Fatemeh Khodadadi1, Masoud Tohidfar2*, Kourosh Vahdati3 and Charles Leslie4
1Department of Plant Pathology, University of Shahid Bahonar, Kerman, Iran
2Faculty of New Technologies and Energy Engineering, Department of Biotechnology, Shahid Beheshti University, G. C. Tehran, Iran
3Department of Horticulture, College of Aburaihan, University of Tehran, Tehran, Iran
4Department of Plant Science, University of California, Davis, CA, USA
*Corresponding Author: Masoud Tohidfar, Faculty of New Technologies and Energy Engineering, Department of Biotechnology, Shahid Beheshti University, G. C. Tehran, Iran, Tel: +98 21 29903244, Email: [email protected]

Received Date: Jan 25, 2018 / Accepted Date: Mar 13, 2018 / Published Date: Mar 16, 2018

Abstract

Polyphenol oxidase (PPO) is a well-recognized copper-containing enzyme which can catalyze oxidation of a great variety of phenolic compounds. PPO is found in diverse microorganisms, plants, and animals. To examine the anti-pathogenic role of PPO in walnut (Juglans regia L.), Agrobacterium tumefaciens strain LBA4404 was used to transform tobacco (Nicotiana tobacum L.) explants. Recombinant binary vector pBI121, containing the walnut JrPPO gene and the nptII gene as a selectable marker, was incorporated into A. tumefaciens. MS medium supplemented with 50 mg/l of kanamycin and 200 mg/l of cefotaxime was used as a selection medium. Plantlets were regenerated from putatively transgenic calli and polymerase chain reaction and Southern blot analysis were performed to confirm the integration of JrPPO into the genome. To evaluate the function of PPO in pathogen resistance, transgenic tobacco plants were exposed to Pseudomonas syringae pv. tabaci. According to symptom progress and quantitative analyses, although there was no significant difference in transgenic tobacco, but mean comparison showed that disease severity of transgenic tobacco was less than wild plants. Finally, it may be concluded that PPO has a notable function in the resistance process in walnut, but tobacco transgenic plants might not be a suitable test plant to examine the resistance role of PPO in walnut.

Keywords: Polyphenol oxidase; Walnut; Tobacco; Pseudomonas syringae pv. Tabaci; Xanthomonas arboricola pv. juglandis

Introduction

Polyphenol oxidase (PPO) is a binuclear copper-containing enzyme with abundant distribution in bacteria, fungi, plants, animals, and humans [1,2]. PPO belongs to the large family of oxidoreductases and catalyzes the oxidation of phenols to quinones. These reactive quinones, due to their ability to link with proteins and other polymers, have a vital function in generation of melanin [3]. Melanin has several impacts in microorganisms, plants, animals and human and also a widespread ranging role in agriculture, food, health and industrial sectors [1]. Multigene families often encode PPOs in plants. For instance, seven genes encode PPOs in tomato (Solanum lycopersicum) genome and six genes in potato (Solanum tuberosum) have been identified to encode PPO. However, only one gene is involved in producing PPO in grape (Vitis vinifera) and lettuce (Lactuca sativa) [4]. Many functions of PPO have been identified, for example its role in browning and biosynthetic processes and aurone formation [5-7].

Although the in vivo functions of PPO to accentuate stress tolerance in various crops have been frequently proved, there is still an absence of clarity for many of PPO functions such as its physiological role in plants [8]. The role of PPO in plant defense systems has been examined by different studies. PPO-overexpressing tomatoes showed the noticeable resistance to Pseudomonas syringae pv. tomato [9]. Resistance to downy mildew (Scerospora graminicola) in pearl millet (Penisetum glaucum), Rastonia solanacearum, and its developmental function in nodules of red clover (Trifolium pratense L.) were attributed to PPO [10-12]. The role of PPO in resistance to the parasitic nematode Radopholus similis has been studied in Banana [13]. Some studies have shown PPO’s function in plant defense against several herbivores [14,15].

The abundance and diversity of phenolic compounds in walnut is remarkable. Hence, walnut is an excellent model in which to check the functions of PPO [16,17]. PPO rapidly responds to wounding and disease-producing agents in potato and tomato [18]. JrPPO1 has been the only PPO gene recognized in walnut. High expression of this gene was being detected in all green tissues. Wounding and methyl-jasmonate treatments were not capable of inducing this gene in walnut [19], but PPO activity is strongly responsive to walnut bacterial blight [20]. Recently, due to numerous phenolic compounds and their rolls in inducing pathogen resistance in walnut [17], several studies have concentrated on PPO activity and evaluation of its functions in resistance to walnut pathogens. For instance, a strong effect of PPO silencing was detected in walnut plants (Juglans regia), suggesting increased susceptibility to oxidative stress [21].

Xanthomonas arboricola pv. juglandis (Xaj) is the causal agent of walnut bacterial blight, the most significant bacterial disease of Juglans regia and other Juglans species, which is present in all moderate regions where English (Persian) walnut (J. regia) is grown.

The action of phenolic compounds has been proved in stress conditions and they play a significant role in the defensive system of walnut against Xaj [22]. To produce walnut plants with increased resistance to varied pathogens such as Xaj, strategies used in other plants such as cotton, could be applied [23]. Transgenic plants with altered PPO expression provide a system in which to evaluate the contribution of PPO to plant disease resistance. The objective of this study was to transform tobacco var. Jafarabadi with the walnut PPO gene using the Agrobacterium system to carry out functional analysis of role of this gene in resistance to Pseudomonas syringe pv. tabaci.

Materials and Methods

Plant material and gene isolation

Walnut cv. Damavand (Z30) leaves were harvested from field-grown trees in Kerman Province, Iran. Total genomic DNA was extracted using DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA), and the specific primers were designed using the available sequence of the J. regia ‘Chandler’ gene encoding PPO (JrPPO-1, accession number FJ769240). To perform the PCR reaction and the amplification of the JrPPO-1 gene (1812 bp), XbaI and BamHI restriction sites were introduced to the 5′-end of these primers F(Xba1) JrPPO-1: TCTAGATGCACATGGCTTCTCTCTTGGCTTC and R (BamHI) JrPPO-1: TGGATCCTAAGTTCAACCGATAAGCACAATCTTGATCC.

The PCR reaction was contained in a 25 µl of volume 1X reaction buffer, 50 ng of DNA template, 1.5 mM MgCl2, 10 pm of each primer, 1 mM of each of the dNTPs, and one unit of long PCR enzyme (Fermentas, Maryland, USA). The PCR program was: 35 cycles of initial denaturation at 94°C for 1 min, annealing at 58°C for 1 min, extension at 72°C for 1 min and a final extension step at 72°C for 10 min. Reaction products were analyzed by agarose (1% w/v) gel electrophoresis and stained by ethidium bromide.

Plasmid constructs

The PCR product was digested with two restriction enzymes, XbaI and BamHI, and subsequently ligated into the homologous sites in pBI121 (without a gus gene), a binary vector used for transformation of tobacco. The colonies of E. coli XL1-blue were allowed to grow on a selective medium containing kanamycin. The presence of the jrPPO1 (1812 bp) fragment in the recombinant plasmid was confirmed using a PCR reaction. Afterward, to confirm the gene orientation, double restriction digestion was done using BamHI and XbaI. The freeze-thaw method was used to transfer this vector into competent cells of Agrobacterium tumefaciens strain LBA4404 [24].

Plant transformation

Seeds of an Iranian tobacco cultivar Jafarabadi (prepared by Tirtash Tobacco Research Center, Gorgan, Iran) were disinfested and grown on a 1/2 MS medium with incubation in a growth chambers at 25°C (16 h light/8 h dark) for 4-6 weeks [25]. The leaf disc method for transformation of tobacco using Agrobacterium was accomplished as previously described [25]. Punched leaf disks were incubated in an Agrobacterium suspension (OD 600 nm = 0.6-0.7) for 5-8 min, blotted on sterile filter paper, and finally transferred to MS co-cultivation medium (MS medium containing vitamins, 0.1 mgl−1 NAA, 1 mgl−1 BAP, and 3% sucrose, pH 5.7) in the dark for 48 h. Subsequently, disks were transformed to MS selection medium including 50 mg/l kanamycin and 200 mg/l of cefotaxime. The explants were incubated at 28°C under an 18 h photoperiod. The sub-culture of these explants was performed every 10 days. The rooting medium (MS medium consisting vitamins, 0.1 mg l−1 NAA, 3% sucrose, pH 5.7 and 0.2% agar) was used to develop the transgenic plants in the final step.

Molecular analysis

DNA was extracted from transgenic and non-transformed tobacco tissue plants using DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). PCR detection of jrPPO-1 was performed using the specific primers mentioned above. Bacterial contamination in transgenic plants was tested using vir gene primers. The PCR reaction consisted of 25 µl final volume containing 1 U of Taq DNA polymerase, 250 mM of each dNTP, 50 ng DNA templates, and 10 pmol of each primer. The PCR program, in 35 cycles, was as follows: initial denaturation at 90°C for 5 min, 35 cycles including denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and synthesis at 72°C for 3 min and finally the last stage was extension at 72°C for 7 min. The primer pairs were Vir-F (ATGATTGTACATCCTTCACG) and Vir-R (TGCTGTTTTTATCAGTTGAG).

Southern blot hybridization

Fifty µg of genomic DNA was digested with BamHI at 37°C. DNA fragments were separated on 0.8% (w/v) agarose gels and subjected to Southern hybridization using a nylon membrane (Hybond N, Amersham, UK) by capillary blotting [26]. A specific probe for the coding sequence of the JrPPO1 gene was prepared by PCR DIG probe synthesis (Roche Applied Science) and overnight (12-16 h) hybridization using DIG Easy Hyb buffer was accomplished. Detection was carried out as in [23].

Disease challenge assays

Overnight liquid cultures of P. syringae pv. tabaci were prepared. Then, 20 μl of the bacterial suspension was placed on the central vein of the leaf in which a wound was made using a scalpel. Afterwards, agar plates (10 g agar l−1) containing sterile filter paper were used to keep the inoculated leaves humid and plates were kept in a controlled environment chamber [27]. Disease severity was determined based on infection severity indexes from 0 to 4 [28]. Disease severity (S) for replicates (five leaves per replicate) was calculated according to disease severity indices.

equation

N is the number of inoculated leaves per replicate and I max is the maximum severity index. Analysis of variance (ANOVA) was calculated for the severity values (S) per replicate using Duncan’s multiple range test [28].

Results

Plasmid construct

The 1812 bp fragment band of JrPPO1 gene from the leaves of ‘Damavand’ was amplified using a PCR reaction (Figure 1). JrPPO1 was cloned into the binary vector pBI121 and presence of the 1812 bp band was confirmed by digestion analysis of the pBI121-JrPPO1 recombinant plasmid using XbaI and BamHI. Presence of the expected 1812 bp product resulted from PCR using the PPO-F and PPO-R primers, confirmed the accuracy of the construct containing the JrPPO fragment (Figure 2).

plant-pathology-microbiology-agarose-gel-analysis

Figure 1: PCR and agarose gel analysis of DNA isolated from leaves of ‘Damavand’ using primer pairs specific for amplification of the 1812 bp PPO (M) and 1.0 kb plus DNA ladder (Lane 1).

plant-pathology-microbiology-enzymatic-digestion

Figure 2: Confirmation using PCR and enzymatic digestion of the presence of the JrPPO-1 fragment in recombinant pBI 121: 1) negative control; M) 1.0 kb plus DNA ladder; 2) 1812 bp JrPPO-1 fragment released after digesting with Xba1 and BamH1; 3) amplification of 1812 bp using PCR.

Plant regeneration

After co-culturing tobacco leaves with the Agrobacterium strain LBA4404 on MS selective medium, kanamycin resistant tobacco microcalli appeared at the edges of explants after approximately three weeks incubation, while no callus was acquired from the untransformed explants (Figure 3). The transformed calli were transferred to MS selection medium containing appropriate antibiotics. Shoots developed from cream-colored calli. A total of 13 shoots with developed leaves were obtained and then transferred to jars on MS4 rooting medium. Root development was detected after 10-20 days (Figures 3A-3E).

plant-pathology-microbiology-tobacco-seeds

Figure 3: Regeneration of transgenic tobacco plants: A: Sterile plants grown from tobacco seeds; B: Excised leaves inoculated with Agrobacterium harboring pBI121 and cultured on selection medium; C: Putative transgenic callus after 20 days; D: Transfer of developed callus to selection medium; D: Plants transferred to the rooting medium.

PCR analysis

After selecting for transformation by growth on kanamycin medium, a total of 13 plants were chosen for DNA extraction and analysis by PCR, using PPO specific primers. Three of these plants showed a single DNA fragment of 1812 bp, the size of band expected for jrPPO-1. Untransformed tobacco plants were negative for the JrPPO1 gene (Figure 4A). One of these transformants showed positive results after amplification of the 800 bp for vir gene (Figure 4B), indicative of residual contamination. Therefore, only the two proven transformants were used for next step. Transformation frequency of the embryos and the plantlets based on the leaf callus assay was approximately 23%.

plant-pathology-microbiology-transgenic-tobacco

Figure 4: PCR analysis of DNA isolated from leaves of transgenic tobacco. A: Using primer pairs specific for amplification of the1812 bp PPO gene in agarose gel. Lane 1, DNA from non-transformed tobacco; Lane 2, DNA from pBI121-PPO; Lanes 3-5, DNA from putative transgenic tobacco lines; M, 1.0 kb plus DNA ladder. B: Using primer pairs specific for amplification of the 800 bp vir gene as a contamination test. M, 1.0 kb plus DNA ladder; Lane 1, DNA from untransformed tobacco; Lane 2, DNA from Agrobacterium (positive control); Lanes 3-5, DNA from putative transgenic tobacco lines; Line 6, PCR negative control without template.

Southern blot analysis

Results of the southern blot analysis are shown in Figure 5. Genomic DNA isolated from leaves of PCR-positive plants was used for Southern analysis to provide further proof of integration of the PPO gene into the tobacco genome. The resulting hybridization signals show that the transgene was effectively integrated. DNA blotting shows that plants 1 and 2 were independent transformants. The 1812 bp PCR product of the coding sequence of the JrPPO-1 gene was used as a probe (Figure 5A). Once the DNA was digested with BamHI (Figure 5B), results showed that three copies of the JrPPO1 gene are present in Line 1 (12 kb, 1800 bp and 3.5 kb) and one copy in Line 2 (12 kb) (Figure 5C). For the DNA extracted from the untransformed plants, no hybridization signal was detected. Southern hybridization was carried out on lines that showed positive PCR results. Incorporation and integration of either one or three copies of the transgenes into the tobacco genome was demonstrated. Line 1 and line 2 had three and one copy of the JrPPO-1 gene integrated into their genome, respectively. The presence of an altered size of hybridization signal in one line was caused by the integration of vir gene into the genome, indicating contamination.

plant-pathology-microbiology-restriction-enzyme

Figure 5: Analysis of genomic DNA by Southern blot. A: PCR–DIG labelling: DIG– dUTP is incorporated during PCR cycles into the DNA strands amplified from the DNA target; B: genomic DNA from transgenic and non-transgenic lines digested with BamHI restriction enzyme; M) 1.0 kb plus DNA ladder; Lanes 1 and 2) BamHI digested DNA from transgenic plants; Lane 3) BamHI digested DNA from non-transgenic plant; Lane 4) BamHI/XbaI digested DNA from plasmid (pBI121- JrPPO-1); C: Confirmation of the presence of JrPPO-1 in putative transgenic tobacco, but not in untransformed tobacco. M) 1.0 kb plus DNA ladder; Lane 1 and 2, BamHI digested DNA from transgenic plants; Lane 3) BamHI digested DNA from non-transgenic plant; Lane 4) BamHI/XbaI digested DNA from plasmid (pBI121-JrPPO-1).

In Vitro assay

To screen the transgenic plants for resistance to P. syringae pv. tabaci, an in-vitro assay was carried out. ANOVA was performed using only severity values from tested plants in which detached leaves were inoculated with the strain P. syringae pv. tabaci. Disease severity of transgenic and wild type (control) plants did not show any significant difference (Figure 6). Severity values for the two inoculated transgenic plants were 50%. Severity values obtained for non-transgenic (control) leaves was 62%. Although there were no significant differences between transgenic and wild type plants, simple comparison of means indicates that disease severity in wild type tobacco plants was greater than in transgenic tobacco plants. In none of the tested plants was necrosis limited to the inoculation point, so necrosis expanded through the main vein and the severity values for all were higher than 30% (Figure 6).

plant-pathology-microbiology-detached-leaves

Figure 6: Severity of infections (%) caused by P. syringae pv. tabaci on detached leaves from two transgenic lines and a non-transgenic (control) tobacco plant. Severity values correspond to the mean of three replicates of five leaves per replicate.

Discussion

Several transgenic plants were generated using a transformation system [29,30]. It was obvious that the presence of kanamycin prevented rooting, so use of antibiotics was eliminated during the rooting stage. In addition, the effect of glucose on callus induction was discernible. Glucose also has been used in other studies [23,25]. Use of Agrobacterium strain LBA4404 has resulted in high transformation efficiency in many other plants [25,30-33]. In this study, the Agrobacterium strain LBA4404 provided efficient transformation of tobacco.

Due to its suspected function as a key part of plant pathogen defense, it was expected that overexpression of PPO in a model plant would enhance pathogen resistance. In this study, the expression of jrPPO1 in transgenic tobacco plants was not able to demonstrate increased resistance to P. syringae pv. tabaci and although no significant differences were statistically observed, disease symptoms appeared somewhat less severe in transgenic plants than in wild type. Our results are in agreement with Escobar’s study in which expression of jrPPO1 in transgenic tobacco plants resulted in no significant effect on susceptibility to the pathogen P. syringae pv. tabaci [19]. Therefore, the main question raised here is whether PPO has any important role in the defense process of walnut. The role of PPO in the resistance of plants to stress and pathogens has been frequently shown by a variety of researchers [5]. Previously, transgenic plants overexpressing PPO showed involvement of this enzyme in disease resistance response to P. syringae pv. tomato [9]. Moreover, induction of PPO in response to wounding and MeJA treatment has been observed in tomato, tobacco and hybrid poplar (P. trichocarpa x deltoides) [18]. In contrast, no increase in PPO activity was observed in response to wounding and MeJA in walnut over a 48-h interval [19].

In spite of the fact that correlation between PPO activity and defense reactions is now well-established, the native physiological role of PPOs in species such as walnut remains vague. There is an extraordinarily wide range of phenolic compounds in walnut [16,17]. Hence, the number of phenolic compounds existing in tobacco leaves is not comparable to walnut [19]. To observe a role of PPO in the defense process of plants, the existence of both phenolic compounds, as substrates, and a PPO enzyme are required. Therefore, an abundance of phenolic compounds is a prerequisite for evaluating the role of PPO expression. The number of phenolic compounds in tobacco leaves is restricted and this limitation may be explanation for the similarity between our findings and Escobar’s results [19]. Tomato and potato are more closely related species than walnut and tobacco. Accordingly, the best result would be achieved when transgenic methods using PPO are used in closely related or identical species. This may be why over-expression of the potato PPO gene in tomato could increase resistance to bacterial blight, because the amount of phenolic compounds, and subsequently PPO activity, would be the same in both plants [9]. Expression of red clover PPO in alfalfa did not inhibit post-harvest proteolysis in forage. It is implied that the main reason is the existence a low level of phenolic compounds in alfalfa [34].

Conclusion

Production of transgenic walnut plants expressing jrPPO1 and an attempt to silence the PPO gene might be an effective method to evaluate the physiological functions of PPO. Our results suggest that transgenic tobacco plants may not provide an appropriate model for testing the ability of PPO to induce resistance because the number of phenolic compounds is insufficient.

Acknowledgments

We would like to thank Shahid Beheshti University, Iran National Science Foundation (INSF) and University of Tehran for their supports.

References

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Relevant Topics
Recommended Conferences
Viewmore
Article Usage
  • Total views: 590
  • [From(publication date): 0-2018 - Oct 20, 2018]
  • Breakdown by view type
  • HTML page views: 550
  • PDF downloads: 40

Post your comment

captcha   Reload  Can't read the image? click here to refresh