alexa Alu-repeat Polymorphism in the Tissue Plasminogen Activator Gene and Risks of Myocardial Infarction in Tunisian Population | Open Access Journals
ISSN: 2161-0444
Medicinal Chemistry
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Alu-repeat Polymorphism in the Tissue Plasminogen Activator Gene and Risks of Myocardial Infarction in Tunisian Population

Raoudha Bahri1, Awatef Msolly2* and Asma Kassab2

1Laboratory of Human Genetics and Anthropology, Faculty of Pharmacy, Monastir, Tunisia

2Department of Biochemistry and Molecular Biology, Faculty of Pharmacy, Monastir, Tunisia

*Corresponding Author:
Awatef Msolly
Department of Biochemistry and Molecular Biology
Faculty of Pharmacy
Monastir 5000, Tunisia
Tel: 00216- 97867155
E-mail: [email protected]

Received date: January 25, 2016; Accepted date: February 02, 2016; Published date: February 05, 2016

Citation: Bahri R, Msolly A, Kassab A (2016) Alu-repeat Polymorphism in the Tissue Plasminogen Activator Gene and Risks of Myocardial Infarction in Tunisian Population. Med chem 6:072-074. doi:10.4172/2161-0444.1000327

Copyright: © 2016 Bahri R, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Medicinal Chemistry

Abstract

This study aimed to determine whether I/D polymorphism predispose to the development of MI in Tunisia. 50 patients with coronary artery disease complicated by MI and 70 healthy controls were analyzed. Quantitative analyses lipids are founded. DNA was isolated from blood samples. Polymorphisms were assessed by polymerase chain reaction method. Statistical differences between groups were determined by Chi-square test. Compared to controls, cases have significantly higher levels of total cholesterol, triglycerides and LDL-cholesterol and lower level of HDL-cholesterol. There are no significant differences between patients and controls in terms of allelic and genotypic frequencies. However, the frequency of the “I” allele is higher in cases which have 2 MI (p=0.0354). Additionally, a statistically significant association between diabetes, arterial high blood pressure, family history and cigarette smoking with MI was founded (p<0.01). I/D polymorphism of t-PA gene is not associated with MI in this sample of Tunisian population.

Keywords

Myocardial infarction; t-PA gene; I/D polymorphism

Introduction

Myocardial infarction (MI) is a coronary artery disease (CAD) caused by the degeneration of heart tissues as a result of blood clot formation in coronary arteries [1]. It represents one of the most important health problems in many nations worldwide [2].

Although the major risk factors of MI are environmental factors such as high blood pressure, hypercholesterolemia, diabetes and cigarette smoking, evidence is accumulating which suggest that genetic polymorphisms have been implicated to the disease progression [3,4]. Furthermore, MI is directly related to the thrombosis-fibrinolysis system which is regulated by factors involved either in clot formation and lysis [5]. Several gene polymorphisms of the fibrinolytic proteins and their cross regulators have been studied [6] and some studies founded that polymorphisms in genes encoding the components of thrombosis-fibrinolytic cascade may be a contributing factor in disease etiology by creating an imbalance between the two processes [7].

Tissue plasminogen activator (t-PA) produced by endothelial cells is involved in the breakdown of fibrin clot by converting plasminogen into plasmin, which then leads to fibrinolysis [8]. The t-PA protein encoded by t-PA gene (LAT) is the inducer of fibrinolysis. The increased enzyme activity causes hyper-fibrinolysis which might leads to excessive bleeding whereas it's decreased activity result in thrombosis. t-PA-antigen might therefore either play an important role in the development and progression of vascular disease, culminating in thromboembolic complications or death, or t-PA-antigen might just indicate the co-existence of confounders such as hypertension, insulin resistance, heart failure or ischemic heart disease, all of which can cause endothelial dysfunction and vascular injury [9]. Several studies founded that a common insertion of an Alu-repeat in the intron 8 of the gene is considered to be involved in plasma levels of t-PA [8,10,11]. In fact, the presence of one I/D allele was associated with a 50% increase in risk of MI, whereas homozygous carriers had a two fold adjusted increase in risk, suggesting an association between the number of Alurepeats and arterial thrombosis [5,12].

The aim of this study is to determine whether I/D polymorphism on the LAT gene predispose to the development of MI in a sample of Tunisian population.

Materials and Methods

Study population

We conducted a case-control study in 50 patients, age 49 ± 6.25 (years), with CAD complicated by MI (confirmed by coronary angiography) ascertained from the Department of Cardiology in Fattouma Bourguiba University Hospital Monastir, Tunisia. The control group included 70 healthy volunteers, age 57 ± 8.37 (years). All subjects participated in the study on a voluntary basis, were interviewed by the same interviewer. The study, in accordance with Helsinki Declaration, was reviewed and approved by the local ethics committee and included only individuals that agreed to participate after reading and signing a free and informed consent form.

Laboratory measurements

Quantitative analyses lipids are founded in controls and patients within 24 h from collection. Plasma levels of total cholesterol (TC), triglycerides (TG) and HDL-cholesterol (HDL-C) were measured by an enzymatic colorimetric assay (using a clinical system, Beckman instruments). LDL-cholesterol (LDL-C) concentrations were calculated by using the Friedewald formula [13].

Leukocyte DNA was extracted from blood samples by routine phenol-chloroform method and amplified by polymerase chain reaction (PCR) using oligonucleotide primers:

5’ primer: 5’GTAAGAGTTCCGTAACAGGACAGCT3’

3’ primer: 5’CCCCACCCTAGGAGAACTTCTCTTT3’

Amplification was performed in an automated thermal cycler (Master cycler). The PCR conditions were 10 min for initial denaturation at 94°C, 30 cycles at 94°C for 1 min for denaturation, 1 min at 60°C for annealing and 2 min at 73°C for extension, followed by 5 min at 72°C for final extension. The amplified product was digested with restriction enzyme. The gel visualizing system was used (Vilber Lourmat, France). The fragments were separated on a 2% agarose gel stained with ethidium bromide.

Statistical analysis

Allelic and genotypic frequencies were calculated by direct gene counting method. Lipid and plasma parameters measures were compared through the student’s t-test. Chi-square test was used to determine if there are any significant differences in polymorphism frequencies in cases compared to control population.

Results

The distribution of the selected characteristics of MI cases and controls are presented in Table 1. The statistical comparison between them showed a significant difference in terms of frequency of diabetes, arterial hypertension and family myocardial infarction history (p<0.01). Compared to controls, cases had significant higher levels of TC, TG, LDL-C and lower levels of HDL-C (Table 1).

- Cases (n=50) Controls (n=70) P
Age (Mean± SD) 49±6.25 57±8.37 0.115
Smoking (n) 39 25 0.0124
Diabetes (n) 25 5 <0.01
Arterial hypertension (n) 23 8 <0.01
Family history (n) 20 6 <0.01
TC (mmol/L) 4.62 ± 0.91 4.01 ± 0.46 <0.001
TG (mmol/L) 1.76 ± 0.77 0.78 ± 0.18 <0.001
HDL-C (mmol/L) 0.92 ± 0.26 1.07 ± 0.12 <0.001
LDL-C (mmol/L) 2.57 ± 0.44 <0.01  

Table 1: Selected characteristics of myocardial infarction cases and controls and lipid levels of the study population.

Different genotypes of LAT gene in cases and controls were identified in electrophoresis patterns of PCR fragments (Figure 1). The two groups showed no significant difference in terms of allele frequency (p=0.143) and genotype frequency (p=0.154) (Table 2). Therefore, the genotype frequency of myocardial infarction cases was 0.24% homozygotes I/I, 0.32% homozygotes D/D and 0.44% heterozygotes I/D, controls showed 0.27% I/I, 0.21% D/D and 0.51% I/D.

medicinal-chemistry-Electrophoresis-PCR-detection

Figure 1: Electrophoresis patterns of PCR fragments for detection of PLAT I/D polymorphism.

  Cases(n=50) Controls(n=70) P
Allelefrequency      
I 0.46 0.52 0.143
D 0.54 0.47  
Genotypefrequency      
I/I, n (%) 12 (0.24%) 19 (0.27%) 0.154
I/D, n (%) 22 (0.44%) 36 (0.51%)  
D/D, n (%) 16 (0.32%) 15 (0.21%)  

Table 2: Allele and genotype frequencies of cases and controls.

The distribution of allele frequency of LAT gene according to MI number for each patient is given in Table 3. The frequency of the allele “I” is higher in cases which have 2 MI (p=0.0354).

Allele Myocardial infraction number (N) P
  N=1 (19 Cases) N=2 (31 Cases)  
I/I 4 (0.210) 8 (0.258) 0.0354
I/D 6 (0.315) 16 (0.516)  
D/D 9 (0.473) 7 (0.220)  

Table 3: Allele frequency according to myocardial infarction number.

Discussion

This work focused on the relation between the polymorphism of PLAT gene and MI disease in Tunisian population. Several studies have investigated the regulating role of t-PA in the degradation of the thrombus and founded that the protein appears to activate the transformation of plasminogen to plasmin, which digests the fibrin clot [14,15]. The I/D polymorphism in the gene coding for t-PA was associated with an increased or decreased levels in serum t-PA. Further, the homozygous genotype I/I of the t-PA gene was associated with a higher risk of MI [16]. In this study, we found no significant differences between the two groups in terms of allelic and genotypic frequencies. Our results are contradictory to findings reported by van der Bom et al. [13] in which the authors founded that I/I genotype was increased o f twice in cases group, but they are consistent with results from others studies. In fact, Steed et al. [17] have founded that cases and controls was relatively similar in term of frequency of “I” allele (0.57% vs 0.58%, respectively) and no association between I/D polymorphism and MI have been noted (p>0.05). Furthermore, Hooper et al. [18] founded that the frequencies of “I” allele was 0.37% in cases and 0.44% in controls. Moreover, in a recent meta-analysis included seven studies which investigated the relationship between t-PA I/D polymorphism and MI, the authors suggests that the polymorphism showed no consistent association with MI [19].

However, in our study we found that I/I and I/D genotype frequencies have a significant increase in patients with two MI compared to patients with one MI (p=0.0354), which may be explained by the impact of the two genotypes on t-PA enzymatic activity.

In terms of lipid levels, plasma TC, LDL-C and TG were raised in the disease group whereas HDL-C was reduced. Interestingly total plasma cholesterol did not discriminate between cases and controls as in other European countries [20]. Multiple regression analysis confirmed the independent predictive role for all of the above mentioned lipid parameters [21,22].

In addition, we have noted a statistically significant association between the environmental factors, including diabetes, arterial high blood pressure, family history and cigarette smoking with MI. This latter result confirms previous association studies where t-PA protein expression was found to be influenced by environmental factors [7,18,23-25].

A discrepant findings support the idea that MI is a multifactorial disease which may be the result of “gene-environment” interaction.

In interpreting the results from our current study, several potential limitations need to be considered. A potential concern is the study sample size that is relatively small. Another potential limitation of our study concerns use of hospital-based cases and controls. While every effort was made to include all cases admitted to the study hospitals, we did not attempt to ascertain patients who may not have come to this hospital. Therefore, the generalizability of our results may be limited because of the hospital-based study design. Additionnally, controls has a higher average age than the MI patients, a study sample with a quite comparative age need to be considered.

Despite these limitations, the study contributes to our understanding of MI in this population and provides some of the first data on relationship between t-PA polymorphism and MI in Tunisia.

Conclusions

Our results demonstrated that the risk allele “I” was not found to be associated with MI. However, I/I and I/D genotype frequencies have a significant increase in patients with two MI compared to patients with one MI. Additionally, we noted a statistically significant association between the environmental factors and MI.

Acknowledgements

We would thank all contributors from the Cardiology Department of Fattouma Bourguiba Hospital, Monastir, Tunisia.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

Article Usage

  • Total views: 8019
  • [From(publication date):
    February-2016 - Sep 20, 2017]
  • Breakdown by view type
  • HTML page views : 7938
  • PDF downloads :81

Review summary

  1. Filzah
    Posted on Sep 29 2016 at 7:24 pm
    Authors investigate the polymorphism factors in MI patients by comparing the data collected from the patients to the control. The paper present very interesting data from MI patients and evaluate the risk based on analysis at the genetic level. The overall writing of this manuscript is good.
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]m

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords