alexa Aryl Hydrocarbon Receptor Activation via Beta Naphthoflavone Disrupts Mouse Mammary Gland Development during Lactogenesis | Open Access Journals
ISSN: 2476-2067
Toxicology: Open Access
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Aryl Hydrocarbon Receptor Activation via Beta Naphthoflavone Disrupts Mouse Mammary Gland Development during Lactogenesis

Kerry R. Belton*

Department of Veterinary and Biomedical Sciences, Center for Molecular Toxicology and Carcinogenesis, The Pennsylvania State University, University Park, PA 16802, USA

*Corresponding Author:
Kerry R. Belton
Department of Veterinary and Biomedical Sciences
Center for Molecular Toxicology and Carcinogenesis
The Pennsylvania State University, University Park, PA 16802, USA
E-mail: [email protected]

Received Date: April 19, 2017; Accepted Date: May 11, 2017; Published Date: May 16, 2017

Citation: Belton KR (2017) Aryl Hydrocarbon Receptor Activation via Beta Naphthoflavone Disrupts Mouse Mammary Gland Development during Lactogenesis. Toxicol Open Access 3:126. doi: 10.4172/2476-2067.1000126

Copyright: © 2017 Belton KR. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Toxicology: Open Access

Abstract

Aryl hydrocarbon receptor (AHR) ligands including 2,3,7,8-tetrachlorodibenzodioxin (TCDD) have been shown to have deleterious effects on lactation. In the current study, the effects of dietary beta naphthoflavone (5,6- benzoflavone, BNF), a potent AHR agonist, were characterized in lactating dams. Using morphologic and molecular techniques we observed disruption of mammary gland differentiation, gene expression, and metabolism in lactating Ahrb (high affinity) mice. Similar effects were absent in lactating Ahrd (low affinity) mice. Quantitative PCR analysis revealed ~50% reduction in the expression of key lactogenesis mammary genes including whey acid protein (Wap), α-lactalbumin (Lalba), and β-casein that is consistent with previous reports. All together results including those from Ahrd (low affinity) mice support that the AHR is an possible important regulator of lactation and BNF in the mammary gland cause serve disruption.

Keywords

Beta naphthoflavone (5,6-benzoflavone, BNF); Aryl hydrocarbon receptor (Ahr-gene); (AHR-protein); Mammary gland

Highlights

• BNF suppresses lactation and milk secretion in nursing dams.

• AHR agonism changes gene expression in the lactating mammary gland.

Introduction

Strikingly, 3-6 million human mothers annually are unable to initiate and nutritionally support their infants through breastfeeding or have significant difficulty doing so [1]. Human epidemiological studies have demonstrated associations between environmental toxicants and defects in lactation [2]. These studies also suggest exposure to endocrine disruptors (e.g., 2,3,7,8-tetrachlorodibenzodioxin, TCDD) during pregnancy have the potential to disrupt lactation [2-5]. Correlations have been made between TCDD exposure and later initiation of breast development in girls [6]. Rodent studies have been instrumental in deciphering the mechanism of impaired lactation following xenobiotic exposure. Several studies have shown that mammary gland differentiation defects are mediated through the aryl hydrocarbon receptor (AHR) [1,4,7-9]. However, the precise metabolic consequences of this dysregulation remains largely unclear.

The AHR is a transcription factor expressed in various cell types and tissues, and studies have confirmed AHR maintains a functional role in xenobiotic metabolism, immune homeostasis, and development [10]. AHR also plays a critical role in cell cycle control, regulation of apoptosis, and cell proliferation [11]. The general role of the AHR in the mammary gland is not clearly understood, although mouse studies have revealed several critical physiological functions for this receptor related to mammary gland differentiation and lactation. For example, AHR protein was detected in the mammary glands during estrousstimulated growth and branching of terminal end buds (TEBs). Comparative analysis of mammary gland development in Ahr-/- with Ahr+/+ littermates revealed a 50% decline in the formation of TEBs at the tips of the mammary ducts in Ahr-/- mice, highlighting the physiological role AHR must play in coordinating development, differentiation, cell growth, and signaling of hormones in mammary tissue [12,13].

The mouse Ahrb (high affinity) and Ahrd (low affinity) alleles express Ahr that exhibits significant differences in dioxin responsiveness. The Ahrb allele exhibits about 10-fold higher affinity for dioxin compared with Ahr expressed from the Ahrd [14]. Mice that express these Ahr alleles on the same genetic background provide an excellent model to further understand various mechanisms of AHRmediated toxicity [15]. In this study BNF, a potent agonist of the AHR, was given to pregnant mice via the diet to study its effects on lactation and metabolism. This study found that dietary exposure to BNF significantly repressed mammary gland differentiation and induced metabolic abnormalities. Understanding mechanisms of toxicity that lead to lactation dysregulation may suggest preventative strategies in humans.

Materials and Methods

Chemicals

The following reagents were obtained for this work: 5, 6- benzoflavone, carmine alum, paraformaldehyde, and methyl salicylate of the highest grade available (Sigma-Aldrich).

Animals and treatments

C57BL/6J mice expressing the Ahrb and Ahrd allele (6-8 weeks) were maintained at Penn State University. Female mice were housed in pairs with male mice and checked daily for the presence of vaginal plugs. Once vaginal plugs were observed in females, the males were removed, and the pregnant mice were housed in pairs for the remainder of the study. Mice were given diets containing 0.5 ppm and 50 ppm BNF (0.5 mg or 50 mg per kilogram of AIN-76A diet, respectively) and control (Dyets, Inc., Bethlehem, PA) ad libitium and were maintained on a 12-h light cycle. Females were maintained on the diet treatment from conception until birth of their pups. Females were sacrificed 1 day after birth using CO2 asphyxiation. Mammary glands were removed, immediately used or frozen in liquid nitrogen, and stored at -80°C. All animal treatments were conducted with the approval of the Institutional Animal Care and Use Committee of Penn State University.

Whole mount analysis

Both mammary glands 5 and 10 were carefully dissected, spread on a glass slide, and fixed overnight in 4% paraformaldehyde solution. Samples were rehydrated (70% ethanol for 30 min, 50% ethanol for 30 min, 30% ethanol for 20 min, 10% ethanol for 20 min, and distilled water for 5 min). Staining was performed overnight with carmine alum (0.2% carmine dye and 0.5% aluminum potassium sulfate), followed by dehydration the following day (70% ethanol for 30 min, 90% ethanol for 30 min, and 100% for 30 min). Mammary glands were cleared with xylene overnight and maintained in methyl salicylate. Sections were examined on an Keyence BZ-9000 (Itasca, IL). Briefly, evaluation of mammary differentiation was performed without knowledge of treatment by three different scientists. Images of the glands were given a differentiation score based on a four-point scale (1 = poor development/differentiation to 4=excellent growth and development) [16]. The subjective scoring scales were based on the lactation stage of differentiation examined, and considered visible populated with alveoli, coverage of the adipose tissue, density of alveoli present, and ductal structures of the parenchymal tissue.

Quantitative real-time PCR

Both mammary glands 9 and 4 were carefully dissected and flash frozen in liquid nitrogen. RNA was extracted from frozen mammary tissue (~50 mg) using TRIzol reagent (Invitrogen). All RNA samples were diluted to 1 μg/μl using nuclease free water. cDNA was synthesized in a 20-μl reaction volume using 1.0 μg of total RNA in 15 μl of nuclease free water, 4 μl qScript cDNA supermix (Quanta, Maryland). 1 μl of cDNA was added to 3.6 μl nuclease free water and 0.4 μl of each forward and reverse primers were added to the solution (900 nM forward, 900 nM reverse). Gene-specific primers were used in each reaction and all results were normalized to β-actin. qPCR assays were carried out using SYBR Green PCR Master Mix (Applied Biosystems, California) on an ABI Prism 7900HT Fast Real-Time PCR sequence detection system (Applied Biosystems). The reactions were analyzed according to the ΔΔCT method. qPCR conditions were 40 cycles of 95°C for 20 seconds; 95°C for 0.01 seconds; 60°C for 30 seconds; 95°C for 15 seconds; 60°C for 15 seconds; and 95°C for 15 seconds Table 1.

Cyp1a1 F: 5'-AGA GGT TGG CGA CTT TGA CCC TTA-3'; R:  5'-ACC TCC CGA AAC TGA TTG CTG AGA-3'
α-lactalbumin F: 5'-ACG CCA CTG TTC AAG CTT CT-3'; R: 5'-ATG ACA TAG CGT GTG CCA AG-3'
β-Casein F: 5'-CAA GAG CAA GGG CCA CAA G-3', R: 5’-TCC TTT CAG CTT CAC CTC CT-3'
Wap F: 5'-CAT GTT CCC AAA AGC CAG CC-3', R: 5'-GAG TTT TGC GGG TCC TAC CA-3'
β-Actin F: 5'-GGC ATA GAG GTC TTT ACG GAT CTC-3' and R: 5' -TAT TGG CAA CGA GCG GTT CC-3'
Vegfa F: 5'-CATCTTCCAGGAGTA CCCCGA-3';R:5'-CACTCCAGGGCTTCATCGTT-3'
cyclinD1 F:5' TCCTCTCCAAAATGCCAGAG -3'; R:  5'-GGGTGGGTTGGAAATGAAC-3'

Table 1: The following primer sets were used.

Data analysis

All experimental data were analyzed using one-way ANOVA followed by Dunnett’s post analysis. Data are presented as mean ± SEM. Sample sizes are indicated in the figure legends. Graphical illustrations and statistical analysis were performed with GraphPad Prism version 6.0 (GraphPad, San Diego, CA). P-values <0.05 were considered statistically significant (*p<0.05; **p<0.01; ***p<0.001).

Results

Effects of dietary BNF on mammary gland morphology

Ahrb and Ahrd mice were treated with dietary BNF (0.5 ppm or 50 ppm) throughout pregnancy. Food intake for 6-8 weeks old mice was estimated to be between 2.5-3.3 g/day. The dose of BNF provided to mice on the 0.5 ppm diet was calculated to be approximately 1-1.5 μg/day while the dose of BNF provided to mice on the 50 ppm BNF diet was calculated to be approximately 100-150 μg/day.

One day after parturition, mammary glands collected from control and Ahrd mice treated with BNF were completely populated with alveoli, to such an extent that they covered the adipose tissue. As a result of the dense alveoli present, ductal structures of the parenchymal tissue are difficult to appreciate at this stage (Figures 1A, D and E). Moreover, during excision, the presence of milk could be noticed in the tissue. In contrast, defects were visible in glands collected from Ahrb mice treated with BNF. For instance, the adipose tissue was apparent, with parenchymal tissue containing fewer numbers of alveoli, and when present, they appeared unfilled and underdeveloped (Figures 1B and C). Based on blinded scoring, BNF exposure through the diet caused significant disruption of mammary gland differentiation in Ahrb mice treated with BNF (Figure 1F). BNF treated Ahrd mice revealed mild but not statistically significant changes in morphology.

toxicology-gland-development

Figure 1: BNF suppresses lactogenic mammary gland development. Female Ahrb mice were given diets containing 0.5 ppm, 50 ppm BNF (0.5 mg or 50 mg per kilogram of base diet) and control (essentially devoid of known Ahr ligands) ad libitum. Mice received the diets from conception until birth and were sacrificed 1-day after giving birth to their pups. Mammary glands were removed and whole mounts were prepared. Representative whole-mount images of the mammary glands from (A) control, (B) 0.5 ppm BNF-treated, and (C) 50 ppm BNF-treated mice are shown. Images were obtained at 4X magnification. BNF fails to suppress lactogenic mammary gland development in low affinity Ahrd mice (D) control, and (E) 50 ppm BNF–treated. Scale bar=200 μm. All experimental data were analyzed using one-way ANOVA followed by Dunnett’s post analysis. Average differentiation score was determined (F) Results are shown as mean ± SEM. n=4-6 per group. *P ≤ 0.05, **P ≤ 0.01. Results are representative of two independent experiments.

Effects of dietary BNF on mammary development gene

Dietary exposure to 50 ppm BNF in Ahrb mice induced a ~60% decrease in VEGFA and prolactin receptor (Plr) (Figures 2A and 2C), compared to control. In contrast, Cyclin D1 gene expression levels were reduced by ~55 to 60% in glands from animals exposed to both 0.5 ppm and 50 ppm BNF diets (Figure 2B). Results in Ahrd mice revealed no significant change in gene expression of these key genes, highlighting that the AHR is the mediator of this gene dysregulation observed in the mammary gland (Figure 2).

toxicology-prolactin-production

Figure 2: Key mammary development genes are suppressed by BNF exposure. Ahrb and Ahrd female mice were sacrificed 1 day after giving birth to their pups. mammary glands were removed for qPCR. (A) Vegfa, (B) Cyclin d1, and (C) prolactin receptor (Plr) ,expression was normalized to β-actin. All experimental data were analyzed using one-way ANOVA followed by Dunnet’s post. Results are shown as mean ± SEM. n=4-6per group. *P ≤ 0.05, **P ≤ 0.01. Results are representative mean of two independent experiments.

Effects of dietary BNF on overall milk secretion and associated milk gene

qPCR analysis of the mammary gland tissue in Ahrb mice revealed that dietary exposure induced a significant increase in the expression of Cyp1a1, in both BNF groups compared to control (Figure 3A). BNF altered the coordinated induction of milk protein (whey acid protein [Wap], β-casein, and α-lactalbumin [Lalba]) genes by greater than 50% in both treatment groups compared to control (Figures 3B-D). BNF exposure (50 ppm) in Ahrb mice significantly decreased β-casein relative protein expression, with a greater than 50% reduction in its production (Figure 3E). Results from Ahrd mice revealed no significant change in gene expression of these milk genes (Figures 3A and D).

toxicology-milk-production

Figure 3: Dietary BNF modulates lactogenic gene expression. Female Ahrb and Ahrd mice were sacrificed 1-day after giving birth to their pups. qPCR was used to measure lactogenic genes key for induction of milk proteins. Gland mRNA expression measured for (A) Cyp1a1, (B) Whey acid protein (Wap), (C) beta-casein, and (D) α-lactalbumin (Lalba). All experimental data were analyzed using one-way ANOVA followed by Dunnett’s post analysis. Results were normalized to β-actin. Results are shown as mean ± SEM. n=4-6 per group. *P ≤ 0.05, **P ≤ 0 .01. β-casein protein expression is suppressed by dietary BNF exposure. (E) Weight- suckle- weight was used to estimate milk production.

Discussion

Using mouse model of lactation, the effects of BNF on mammary gland function were investigated. BNF is similar in structure to many environmental toxicants. Various studies using TCDD have demonstrated how AHR activation affects pregnancy-associated mammary gland differentiation [9,17-19]. Mechanistic studies using reciprocal transplant with Ahr-/- mammary glands implicated both indirect, systemic effects, and direct cellular consequences of AHR signaling on alveolar differentiation [19]. Further studies have also shown TCDD-induced impairment of mammary gland development during pregnancy is not caused by premature involution or apoptosis. The data suggest that TCDD decreases epithelial cell proliferation [18]. However, recent reports have suggested that AHR agonists (e.g., TCDD) directly block milk production [20]. Specifically, mechanistic studies suggest a role for the aryl hydrocarbon recptor repressor (AHRR) in mediating this lactation suppression of the mammary tissue directly [20].

Similar to other studies using the extensively investigated pollutant TCDD, our study suggests BNF interrupted the differentiation of the mammary gland and its associated milk production [9,17,21]. Studies have shown that prenatal TCDD exposure can cause pups to gain significantly less weight. However, it is unclear whether this is due to physiological changes in the mammary of the dams or to the pups themselves. Future studies to understand the physiologic effects of BNF on the pups directly are warranted.

In the current study, BNF impaired the production of milk protein genes β-casein, Wap, and Lalba which is consistent with previous reports [18-20]. Casein and whey protein, both important milk proteins, are molecular markers for functional differentiation in the mammary gland. Genes for these proteins are controlled by the lactogenic hormone prolactin, insulin, hydrocortisone, cell-cell interactions, and cell-substratum interactions. Generally, our data suggests that BNF impairs the production of milk via the disruption of milk protein genes production and lactational development. Together these results further support the idea that activation of the AHR can lead to deleterious effects on mammary glands during lactation. Furthermore, it is shown here for the first time that BNF is capable of affecting mammary function.

It is possible that the effects of BNF in mammary dysfunction could be due to chronic dietary exposure and subsequent continuous Ahr activation. Another possibility is that a BNF metabolic product could be causing the observed metabolic effects. Though, this would need further study.

Conclusions

This data highlights the possibility of AHR as a target and that lactation difficulties can be treated or possibly enhanced through natural or pharmacological interventions. It is well established that lipophilic toxicants can accumulate in adipocytes that compose the fat pad portion of the mammary gland. Therefore, comparing the mammary profiles of virgin BNF treated and untreated mice would offer further insight into lactation specific changes in the mammary gland. Further studies could include isolating mammary epithelial cells from mice BNF treated and untreated to observe metabolic differences in that particular cellular compartment. It is also possible that toxicants could induce cellular injury in the mammary gland. This injury response could contribute to the overall altered profile. Therefore, further studies could include pro-inflammatory profiling and immunohistochemistry to observe any inflammatory responses to BNF in the mammary gland.

Acknowledgments

This work was supported in part by the Training in Animal Models of Inflammation National Institute of Allergy and Infectious Disease award [T32-2T32AI074551-06], the Huck dissertation research award, the Bill and Melinda Gates foundation.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

Article Usage

  • Total views: 90
  • [From(publication date):
    May-2017 - Jun 28, 2017]
  • Breakdown by view type
  • HTML page views : 68
  • PDF downloads :22
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords