alexa Assessment of Bacterial and Fungal Contamination in Public Swimming Pools in Shahrekord - IRAN | Open Access Journals
ISSN: 2329-891X
Journal of Tropical Diseases & Public Health
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Assessment of Bacterial and Fungal Contamination in Public Swimming Pools in Shahrekord - IRAN

Shirin Saberianpour1*, Hassan Momtaz2, Fahimeh Ghanbari3 and Farhad Mahmodi2

1Young Researchers and Elite Club, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran

2Department of Microbiology, Faculty of Basic Sciences, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran

3Department of Microbiology, Faculty of Basic Sciences, Islamic Azad University, Flavarjan, Isfahan, Iran

*Corresponding Author:
Shirin Saberianpour
Young Researchers and Elite Club
Shahrekord Branch, Islamic Azad University
Shahrekord, Iran
Tel: 98 21 4486 5179
E-mail: [email protected]

Received Date: October 18, 2015 Accepted Date: December 04, 2015 Published Date: December 11, 2015

Citation: Saberianpour S, Momtaz H, Ghanbari F, Mahmodi F (2015) Assessment of Bacterial and Fungal Contamination in Public Swimming Pools in Shahrekord - IRAN. J Trop Dis 4:190. doi:10.4172/2329-891X.1000190

Copyright: © 2015 Saberianpour S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Tropical Diseases & Public Health

Abstract

Background and Purpose: The swimming pool is an important center of entertainment for the public. Pool area is very suitable for the transmission of various diseases, especially fungal and bacterial contamination. The aim of this study was to identify the fungus Candida Albicans, Aspergillus and Penicillium and different bacterial elements in public swimming pools in the fall of 2014.

Methods: In this descriptive study, five public swimming pools were investigated in Shahrekord to examine the water contamination for fungal infection in the swimming pools during autumn of 2014. Sampling was done in two different times, and all the microbiological, chemical, and physical tests were done through standard methods. Test parameters included counting and identification of bacteria and fungi, and assessment of the remaining chlorine and pH level.

Results: The results revealed that the average pH and chlorine levels were 7.8 and 1.62 mg/L, respectively. The isolated sample of bacteria included Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, and Staphylococcus epidermidis. Other strains of bacteria, i.e. Bacillus cereus, Enterobacter faecalis, Enterobacter aerogenes, and Clostridium perfringens were reported negative. Of 21 strains sampled from five swimming pools in Shahrekord, Penicillium species with 9.52% percent, Candida albicans with 4.76 percent, and Aspergillus species with 9.5 % were isolated.

Conclusions: As public swimming pools can be contaminated with different types of parasites and also fungi, observing personal and environmental hygiene, and following standards for remaining free chlorine in water can help reduce the fungal contamination. Considering the fact that most of the bacteria isolated from the pool water in the study contained Escherichia coli, we can conclude that improving the environment and hygienic behavior of the swimmers can be effective in reducing the bacterial contamination in the pools.

Keywords

Swimming pool; Fungal contamination; Bacterial contamination; Remaining free chorine

Introduction

Public swimming pools are among the water recreation centers that attract many fans to themselves. However, microbial and bacterial contaminations in water and the environment of pools can cause ear and eye infections, digestive system infections, skin diseases, and infections of the upper respiratory tract in swimmers, especially those with immune system deficiencies [1-3]. Pool water is exposed to contamination from body fat and waste material such as nasal secretions, saliva, sweat, fecal, urine, and body lotions and creams. Moreover, hair and dust from the surrounding environment can also cause water contamination. The contamination in swimming pools is divided into three categories of physical, chemical, and microbial contamination. Studies have shown that pool water can act as a medium to spread fungal diseases among the swimmers. Swimmers, who swim at contaminated pools, are prone to fungal infection, as the exterior ear, and toe intervals etc. have a relative level of moisture. Previous studies have revealed that physic-chemical factors such as pH are very influential. If the water pH is alkaline, chlorine antiseptic performance will decrease. Pools which have a high temperature provide the grounds foe fungal contamination. Moreover, other microorganisms such as fecal based bacteria (Escherichia coli), and Pseudomonas aeruginosa, Fecal streptococcus, and Marinum are among other microorganisms that are found to contaminate water in swimming pools [4,5].

Based on the studies done on the water n swimming pools within and outside Iran, it has been revealed that Pseudomonas aeruginosa, fecal streptococci and fecal coliforms are relatively contaminant [6-14]. According to the mentioned studies, defining hygiene standards to control water-based diseases is one of the most influential factors to ensure the safety of the pool water and the health of swimmers. Thus, investigating the hygienic criteria of the water in swimming pools seems necessary. Considering the new criteria, physical factors including the pH, remaining free chlorine, and temperature are among the most important factors to control the quality and quantity of microbial contamination. The current study aims at identifying a number of contaminant bacteria strains and investigating the effect of pH and the remaining free chlorine on Aspergillus, Penicillum, and Candida albicans strains in swimming pools in Shahrekord.

Materials and Methods

The current article is a descriptive-cross sectional study done to investigate the bacterial contamination in the swimming pools in the fall of 2014, in Shahrekord. 21 samples were taken from low-depth and 5 meter high depth sections of the pools at two different times. In order to assess the pH and the level of remaining free chlorine, Merck-11134 kit was used. To isolate the sample from the water, 1000 mL sterile bottles were used. The samples were transferred to the Research Laboratory of Microbiology, at Islamic Azad University of Shahrekord. In order to neutralize the remaining chlorine, the samples were passed through 0.45 micron sterile syringe filters, and then 2 mL lysis buffer was forced through the filters. Applying phenol and chloroform, DNA was extracted from the samples. The extracted DNA was then categorized based on 18SrRNA primers. Each bacterium was isolated and investigated applying multiple PCR method, using temperature program including an initial cycle of 94°C for 6 min and 34 repeated cycles of 95°C for 1 min, 58oC for 1 min, and 72oC for 1 min, and a final cycle of 72°C for 8 min. The data on this is given in Table 1. To track the PCR amplifications, gene fragments were analyzed by Agarose gel electrophoresis. 15 microliter of the PCR product from each stage of the experiment was exposed to 100 BP DNA marker with 1.5% Agarose gel in 130 volts for about 45 minutes. The resulting gel was then viewed with UV Illuminator and the observed BP bands of 158, 357, and 570 were related to fungal species of Candida albicans, Aspergillus species and Penicillium species, respectively.

Bacterium Primer (5’- 3’) Length bp Reference
Escherichia coli AGAGTTTGATCCTGGCTCAG 270 15
  GGTTACCTTGTTACGACTT    
Pseudomonas aeruginosa AGAGTRTGATCMTYGCTWAC 136 16
  CGYTAMCTTWTTACGRCT    
Bacillus cereus TGCAACTGTATTAGCACAAGC T 533 17
  TACCACGAAGTTTGTTCACTACT    
Staphylococcus aureus CGA TTC CCT TAG TAG CGG CG 1267 18
  CCA ATC GCA CGC TTC GCC    
Staphylococcus epidermidis AGAGTTTGATCCTGGCTCAG 550 19
  TACCGCGGCTGCTGGCAC    
Enterococusfecalis GTT TAT GCC GCA TGGCAT AAG AG 310 20
  CCG TCA GGG GAC GTTCAG    
Enterobacteraerogenes ATG TCT GGG AAA CTG CCT GAT GGA   21
  ACT TTG GTC TTG CGA CGT TAT GCG    
Clostridium perfringens AAAGATGGCATCATCATTCAAC 279 22
  TACCGTCATTATCTTCCCCAAA    

Table 1: Primers used for gene detection of bacterial species..

Results

The findings of physiochemical investigation of the water from 5 swimming pools in Shahrekord revealed that the average remaining free chlorine in the water was 1.62 mg/L, and the average pH was 7.8. The results showed that the highest bacterial contamination was for Escherichia coli with 95.23 percent. The prevalence of other bacteria species, including Staphylococcus aureus, Pseudomonas aeroginosa and Staphylococcus epidermidis was 19.04, 9.52 and 4.76 respectively. Existence of other bacteria, such as Bacillus cereus, Enterococcus faecalis, Enterobacter aerogenes and Colestridium perfringenes was reported negative [15-20].

The findings of the first physiochemical parameters analysis of the isolated bacterial species from the studied pools are given in Table 3.The highest level of remaining free chlorine is for pool number 4, and the lowest is for pools number 1 and 5. Among 21 studied samples from the pools, fungal species of Penicillium species with 9.52% percent, Candida albicans with 4.76 percent, and Aspergillus species with 9.52 percent were isolated from water. The results of the second and third sampling for each pool are given in Tables 2 and 3. The average remaining chlorine was 1.73 mg/L and the pH was in suitable range. During the second sampling, which was done 30 days after the first time, the highest level of remaining free chlorine was in pool number 4, and the lowest in pool number 5. Compared to the first sampling, the amount of bacterial contamination in pools number 1 and 2 was reduced which might be due to the increase in the level of remaining free chlorine in water. In average, the level of free chlorine and pH in the water in these pools was in an acceptable range [21-24].

Fungus Primer (5’- 3’) Length bp Reference
Candida albicans GCC GGT GAC GAC GCTCCA AGA GCTG 158 bp 23
  CCG TGT TCA ATT GGGTAT CTC AAG C    
Aspergillus species CGGCCCTTAAATAGCCCGGTC 357bp 24
  ACCCCCCTGAGCCAGTCCG    
Penicillium species TCCGTAGGTGAACCTGCGG 570bp 25
  TCCTCCGCTTATTGATATGC    

Table 2: Primers used for gene detection of fungal species.

Penicilliumspecies Aspergillusspecies Candida albicans Residual chlorineppm PH   Pool
+ + - 0.6 favorable Shallow 1
- - -     Deep  
- - - 2 favorable Shallow 2
- - -     Deep  
- - - 1.5 favorable Shallow 3
- - -     Deep  
+ - + 2.5 favorable children  
- - - 2.5 favorable Shallow 4
- - -     Deep  
- - - 1 favorable Shallow 5
- - -     Deep  

Table 3: Determine amount offree residual chlorine, PH and fungal contamination.

Penicilliumspecies Aspergillusspecies Candida albicans Residual chlorine ppm PH   Pool
- - - 2 favorable Shallow 1
- - -     Deep  
- - - 2 favorable Shallow 2
- - -     Deep  
- - - 2 favorable Shallow 3
- - -     Deep  
- - - 2.5 favorable Shallow 4
- - -     Deep  
- + - 0.5 favorable Shallow 5
- - -     Deep  

Table 4: Determine amount offree residual chlorine,PH and fungal contamination.

Discussions and Conclusions

Swimming in the swimming pools is very advantageous to public health and welfare. Although, at the first glance, pool water cannot be considered as an ideal fungal infection transmitter, it may cause certain threats to the swimmers [25]. Nevertheless, the physical environment of swimming pool is highly humid and warm, which makes it a suitable environment for fungi spread and cultivation. Most of Saprophyte fungi, such as different species of Aspergillus, Penicillium, Mucor and Rizopus grow easily in humid and warm environments [26,27].

During the current study, Penicillium species with 9.52% percent, Candida albicans with 4.76 percent, and Aspergillus species with 9.52 percent were reported positive among the 21 samples taken from the 5 swimming pools in Shahrekord. According to the results, pH was in an acceptable range and there was no statistically significant difference between the level of remaining chlorine in the low-depth and deep sections of the pools. Among similar studies done in different cities in recent years, we can refer to Shadzi et.al. in which, using filtration and carpet sampling methods, fungal contamination was investigated in four public swimming pools in Isfahan. A sum of 60 samples were used to isolate the studied fungi from water and the surrounding environment of the pools (cloak room, foot wash, and the shower) in different seasons. The most prevalent fungi were in order cladosporium with 34.9%, Penicillium with 31.2%, Rizopus with 9.7%, Aspergillus With 9.2%, Yeasts With 6.2% and unidentified string fungi with 8.8%. Moreover, Trichophyton mentagrophytes was isolated from 9 cloak rooms and showers [28]. The results of the mentioned study are almost identical to those of the current study. In another study done by Jafari et al. in indoor pools in Yazd, a total of 720 samples were cultured and the study revealed that 68.7% of the samples were contaminated with one or more fungi, which is way beyond the results of this study [29]. The study done by Shahriari et al. on the prevalent microbial criteria in the swimming pools in Gorgan revealed that there was a relative contamination in the samples taken from pools without remaining free chlorine. However, there was no statistical significant difference between the levels of remaining free chlorine and the contaminations in the water of swimming pools in Shahrekord [30]. The current study, along with other studies done in Iran, show that measuring some physicochemical criteria can, to a great extent, help prevent and control microbial and fungal factors in the pool water. Findings also suggest that the level of remaining free chlorine in the pool water must be in the range of 1 to 2 mg/L, or otherwise some fungi may get the opportunity to grow [31]. In our study, the average free chlorine level was 1.73 mg/L, which is acceptable. Feuerman et al. suggested that there was no Dermatophyt contamination in the water samples from the pools which were washed with chlorine [32]. Another study done by Roy et al. in the U.S. concluded that whenever the pH, remaining free chlorine, and the swimming load of a pool is given, a perfect judgment can be made about the contamination in water with 95% certainty [33]. In the current study all the swimming pools had normal pH levels. Based on the findings of the current study, we can conclude that although swimming pools can be contaminated with different microbial factors, the current disinfection methods are based on the standards. Taking a shower and washing the body with soap, as well as observing the standards of pH and free remaining chlorine are amongst the other physical factors contributing to the prevention of microbial and fungal contaminations in swimming pools. Studies indicate that swimming pools play a significant role in spreading bacterial, fugal, viral, and parasitic diseases [34]. The most prevalent ways of microbial spread in pools are exposure and swallowing water from the sections that are not sufficiently disinfected. Skin contamination in swimmers and lack of precise disinfection in pools can help spread diseases [35].

In the current study, the average pH was 7.8. The acceptable pH for swimming pool water is 7.2 to 8. In low pH environment, problems such as itch, chlorine loss, skin spots, and sore eyes can occur in swimmers . According to national standards, pH should be between 7.2 to 8, and the level of free remaining chlorine should be 1 to 2 mg/L [36]. In the current study, the level of free chlorine was in the acceptable range.

The current study involved 21 samples, in which Escherichia coli with 95.23% had the highest prevalence rate among the water contaminants. Existence of other bacterial contaminants such as Pseudomonas aeroginosa. (9.52%), Staphylococcus aureus (19.04%), Staphilococus epidermitis (4.76%) was reported positive. However, existence of other bacterial contaminants such as Bacillus cereus, Enterococus fecalis, Enterobacter aerogenes and Colestridium perfringenes was reported negative. Findings show that in all cases, Escherichia coli contamination has exceeded the standards. As Escherichia coli can enter water from organic, soil, and bodily waste origins including contaminated environment, swimsuits, or fecal, positive existence of Escherichia coli indicates the existence of other bacteria. Escherichia coli prevalence and its spread to swimmers can cause severe diarrhea and digestive system problems.

In another study done in Switzerland, Barben et al. argued that from a sum of 117 samples taken from 46 swimming pools during the summer, 3 samples were contaminated with Pseudomonas aeroginosa. This study also revealed that the mentioned swimming pools were insufficiently disinfected [37].

Staphylococcus aureus is the cause of dermal and eye infections, exterior ear inflammation, uterine infections and Impetigo, and is found in nasal mucosa, on skin, and in meconium [38]. Letting out mucosa from nose, ears, and throat into water, involuntary urinating, and the exposure of skin contaminations to water increases the chances of getting Staphylococcus aureus related diseases [39]. According to the current study, the prevalence of the mentioned bacterium was 19.04%. Another microorganism criterion related to low quality of recreational water is fecal-based Enterococcus. These microorganisms are found in the intestines of human and warm-blooded animals and is used to track down fecal-based contamination. During the present study, no fecal Enterococcus was found. Heterotroph bacteria including Enterobacter are among the opportunist pathogens, and the maximum allowed number of them is 200 per each mL of water [40]. Statistical analysis of the data revealed that there is a reverse relationship between the number of heterotrophic bacteria and the remaining free chlorine (P value=0.031). The number of disease inducing factors found in the second sampling, which was done 30 days later, decreased in pools number 1 and 2. This is due to the increase in the level of remaining free chlorine in the water of these two pools in the second sampling. In order to increase the quality of the water in swimming pools, and to prevent the spread of diseases, observing hygienic standards, including improving the environment of the pool, taking showers, and washing the body with soap prior to the entrance into the pool is highly suggested. In addition, swimmers must be trained to observe the hygienic standards before entering, and while swimming in the pool.

References

  1. Dumani A, Yoldas O, Yilmaz S, Koksal F, Kayar B, et al.(2012) Polymerase chain reaction of enterococcus faecalis and candida albicans in apical periodontitis from Turkish patients. Journal of clinical and experimental dentistry4: e34.
  2. Rabi A, Khader Y, Alkafajei A, Aqoulah AA (2007) Sanitary conditions of public swimming pools in Amman, Jordan. International Journal of Environmental research and Public health4: 301-306.
  3. Schets FM, Schijven JF, de RodaHusman AM (2011) Exposure assessment for swimmers in bathing waters and swimming pools. Water research45: 2392-2400.
  4. Itah AY, Ekpombok MU (2004) Pollution status of swimming pools in south-south zone of south-eastern Nigeria using microbiological and physicochemical indices. Southeast Asian J Trop Med Public Health 35: 488-493.
  5. Ehrampoosh MH, Jafari AA, Rahimi S, Ghaneian MT, Khabiri F(2011) Study of Dermatophytic Fungal Species in Covered Swimming Pools in Yazd, Iran . ‎Health System Research 7: 373-380.
  6. Nikaeen M, Hatamzadeh M, VahidDastjerdi M, Hassanzadeh A, Mosavi Z, et al.(2010) An investigation onphysical, chemical and microbial quality of Isfahan swimming pool waters on standard indicators. Journal ofIsfahan Medical School 28: 346-356.
  7. Rasti S, Assadi MA, Iranshahi L, Saffari M, Gilasi HR, et al. (2012) Assessment of Microbial Contamination and PhysicochemicalCondition of Public Swimming Pools in Kashan, Iran. Jundishapur J Microbiol 5:450-455.
  8. Neghab M, GorjiHA, Baghapour MA, Rajaiifard AR (2004) Survey on water contamination of swimming poolsin Shiraz. Scientific Journal of Kurdestan University of Medical Sciences 31: 41-49.
  9. Nanbakhsh H, Diba K, Hazrati Tape K (2005) A survey on fungal contamination and some physicochemicalparameters of indoor pools in Orumieh. Scientific Journal of Kurdestan University of Medical Sciences 10: 26-35.
  10. Nourian AA, Badali H, Hamzei H (2004) A survey on fungal contamination of indoor pools in Zanjan in 2003.Scientific Journal of ZanjanUniversity of Medical Sciences 48: 43-48.
  11. Mehdi Nejad MH (2003) The determination of quality of healthy indicators in swimming pools in Gorgan. J GorganUniv Med Sci5:84-97.
  12. Azizjalali MH, Behrangi E (2009) Study of the Prevalence of TineaPedis in Swimmers of the West Pools of Tehran in 2007. Journal of Iran University of Medical Sciences 16: 94-102.
  13. Kazemifard H, Jandaghi GR, Safdari M, Azizifar M (2006)The study of Dermatophytic infections in public swimming pools of Qom city during 2004. Journal of Arak University of Medical Sciences 9: 1-6
  14. Dindarlu K, SoleimaniAhmadi M, Zare S, Abdi H, Heidari M (2005) Sanitary condition of swimming pool inBandarabbas in second half of 2003. Medical Journal of Hormozgan 9: 41-46.
  15. James G (2010) Universal bacterial identification by PCR and DNA sequencing of 16S rRNA gene. In PCR for clinical microbiology209-214.
  16. TripathiP, Banerjee G, Gupta MK, Saxena S, Ramteke PW (2013). Assessment of phylogenetic affiliation using 16S rRNA gene sequence analysis for Pseudomonas aeruginosa in patients of lower respiratory tract infection. The Indian journal of medical research138: 557.
  17. Das S, Surendran PK, Thampuran N (2009) PCR-based detection of enterotoxigenic isolates of Bacillus cereus from tropical seafood. Indian J Med Res 129: 316-320.
  18. Moussa I, Shibl AM (2009) Molecular characterization of methicillin-resistant Staphylococcus aureus recovered from outpatient clinics in Riyadh, Saudi Arabia. Saudi medical journal30: 611-617.
  19. Hong T, Li X, Wang J, Sloan C, Cicogna C (2007) Sequential linezolid-resistant Staphylococcus epidermidis isolates with G2576T mutation. Journal of clinical microbiology45: 3277-3280.
  20. Veleba M, De Majumdar S, Hornsey M, Woodford N, Schneiders T (2013) Genetic characterization of tigecycline resistance in clinical isolates of Enterobacter cloacae and Enterobacteraerogenes. Journal of Antimicrobial Chemotherapy68: 1011-1018.
  21. Yoo HS, Lee SU, Park KY, Park YH (1997) Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. Journal of Clinical Microbiology35: 228-232.
  22. Melchers WJ, Verweij PE, Van denHurk P, Van Belkum A, De Pauw BE, et al. (1994) General Primer-Mediated Pcr For Detection Of Aspergillus Species Journal Of Clinical Microbiology 32: 1710-1717 .
  23. Demirel R, Sariozlu NY,Ilhan S (2013)Polymerase Chain Reaction (PCR) Identification ofTerverticillatePenicilliumSpecies Isolated fromAgricultural Soils in Eskisehir ProvinceBraz Arch BiolTechnol56: 980-984 .
  24. Nourian AA, Badali H, Hamzhei H (2006) Fungal contamination in indoor swimming pools in Zanjan-Iran 2005. Pak J BioSci 9:2524-2527.
  25. Hilmarsdottir I, Haraldsson H, Sigurdardottir A, Sigurgeirsson B (2005)Dermatophytes in a swimming pool facility:difference in dermatophyte load in men's and women's dressing rooms. ActaDermVenereol85:267-268.
  26. Rafiei A, Amirrajab N (2010) Fungal Contamination of Indoor Public Swimming Pools, Ahwaz, South-west ofIran. Iran J Publ Health39:124-128.
  27. Shadzi SH., Pour MH.,Zare A, Chadeganipour M(2001)Fungal contaminations in four swimming pools in isfahan, iran.Iran J Basic Med Sci 4:  9-12.
  28. Jafari A, Ghaneian M, Ehrampoush M, Zarei S (2011) Survey of Fungal Contamination in Surfaces of Yazd indoor Swimming Pools in. Toloo-E-Behdasht   12: 61-69.
  29. Shahriari A, Nafez AH, Norouzi S, Heidari M (2012) Investigation of Common Microbial Indicators in Swimming Pool of Gorgan City. J Health Hyg 2: 17-26.
  30. Nichols G (2005) Infection risks from water in natural and man-made environments. Euro Surveill11: 76-78.
  31. Feuerman EJ, Alteras I, Lehrer N (1977) On the occurrence of pathogenic dermatophytes in some swimming-pools from Tel Aviv area. Castellania5: 121-122.
  32. Paul RA (1972) An environmental mode for swimming pool bacteriology. Am J Public Health62: 770-772.
  33. Merz M, Krastl G, Kühl S, Filippi A (2011) A survey of Swiss swimming pool attendants’ knowledge of first-aid treatment after lip and dental injuries. SchweizMonatsschrZahnmed121: 528-536.
  34. Brewster DH, Brown MI, Robertson D, Houghton GL, Bimson J, et al. (1994) An outbreak of Escherichia coli O157 associated with a children›s paddling pool. Epidemiol Infect.112: 441-447.
  35. Seyfried PL, Fraser DJ (1980) Persistence of Pseudomonas aeruginosainchlorinated swimming pools. Can J Microbiol 26:350-355.
  36. Mehdinezad MH (2003) The determination of quality of healthy indicators in swimming pools in Gorgan. J GorganUni Med Sci 5: 89-95.
  37. Barben J, Hafen G, Schmid J (2005) Pseudomonas aeruginosa in public swimming pools and bath-room water of patients with cystic fibrosis. J Cyst Fibros; 4: 227-231.
  38. John DT, Petri WA (2006) Markell and Voge,s Medical parasitology. 9th edn. Markell and Voge's Medical Parasitology,Tulsa.
  39. Gregori NZ, Fechter HP, Miller D, Perez E, Diaz M (2003) A Comparison of Bacteria Present in South Florida Ocean and Pool Water with Known Ocular Pathogens. Invest Ophthalmol Vis Sci 44: 1428.
  40. Casanovas-Massana A, Blanch AR (2013) Characterization of microbial populations associated with natural swimming pools. Int J Hyg Environ Health 216: 132-137.
Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8305
  • [From(publication date):
    April-2016 - Sep 22, 2017]
  • Breakdown by view type
  • HTML page views : 8160
  • PDF downloads :145
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

en[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords