alexa Autosomal Dominant Corneal Dystrophy with TGFBI Mutations: Lessons Learned from a Chinese Pedigree | Open Access Journals
ISSN: 2157-7412
Journal of Genetic Syndromes & Gene Therapy
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Autosomal Dominant Corneal Dystrophy with TGFBI Mutations: Lessons Learned from a Chinese Pedigree

Anli Shu1, Zheng Wei2, Yibin Hao3, Hai Luo1, Fu Tian3, Fred G Biddle4, Wei Wu3,5, Min Liu3 and Wei Cao3*

1Hunan University of Medicine, Huaihua 418000, Hunan Province, China

2Department of Experimental Laboratory, General Hospital of Shenyang Military Area Command, Shengyang 110840, China

3Clinical Research Laboratory, Zhengzhou Central Hospital, Zhengzhou University, China

4Department of Medical Genetics and Department of Biological Sciences, University of Calgary, Canada

5Department of Pathology and Experimental Medicine, University of Calgary, Canada

*Corresponding Author:
Wei Cao
Clinical Research Center, Zhengzhou Central Hospital
affiliated to Zhengzhou University; 195 Tongbai Road
ZhengZhou, Henan Province, 450000, China
Tel: 0118637167077619
E-mail: [email protected]

Received: June 23, 2015; Accepted: July 30, 2015; Published: August 06, 2015

Citation: Shu A, Wei Z, Hao Y, Luo H, Tian F, et al. (2015) Autosomal Dominant Corneal Dystrophy with TGFBI Mutations: Lessons Learned from a Chinese Pedigree. J Genet Syndr Gene Ther 6:264.doi:10.4172/2157-7412.1000264

Copyright: © 2015 Shu A, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Genetic Syndromes & Gene Therapy

Abstract

Corneal dystrophies are rare autosomal dominant genetic diseases with diverse anatomic classification. The complexity of this disease reflects both the heterogeneity of causative gene mutations and the diversity of clinical presentations. Here, we studied and report a four-generation Chinese pedigree with corneal dystrophy, in which the clinical symptoms resemble Meesmann corneal dystrophy without the characteristic gene mutations of either KRT3 or KRT12. Targeted exon sequencing with PCR methods identified an Arg124Cys mutation in the TGFBI gene that concordant with phenotype in all affected individuals. This TGFBI mutation has been associated with multiple subtypes of corneal dystrophy. We reviewed the global reported TGFBI mutations in different ethnic groups and geographically mapped TGFBI mutations previously reported in China. The distribution of TGFBI allelic mutations may assist the clinical diagnosis of the heterogeneous, autosomal dominant corneal dystrophies.

Keywords

Corneal dystrophy; TGFBI; Genetic heterogeneity; Phenotypic heterogeneity

Introduction

The relationship between phenotype and genotype is a central element for accurate clinical diagnosis of disease and assessment of its potential for treatment. This is especially true with the extensive genotypic heterogeneity that underlies phenotypic expression of the corneal dystrophies. We illustrate our experience with a large family that came to our clinical attention with a dominant corneal dystrophy that was initially assessed as Meesmann corneal dystrophy [1].

Corneal dystrophies are rare and usually autosomal dominant genetic disorders with bilateral, symmetrical, and non-inflammatory progressive corneal opacities that lead to varying degrees of visual impairment [2]. Although they are rare, the corneal dystrophies are phenotypically complex with the involvement of one or more of the five distinctive corneal layers and they have an extensive eponymous classification. Structural location has categorized the phenotypic heterogeneity of corneal dystrophy into anterior or superficial dystrophy (including the epithelium and Bowman membrane), middle or stromal dystrophy and posterior dystrophy (including the Decemet membrane and endothelium). Different gene mutations have been identified worldwide in families of different ancestries with corneal dystrophy and these different gene mutations have added a layer of genetic complexity to the existing phenotypic complexity. Multiple and independent allelic mutations have been identified so far in at least 12 different genes that map to 9 different chromosomes (Table 1). These genes are beginning to assist clinical assessment because they are associated with different categories and subtypes of corneal dystrophy as well as with their more historical eponymous classifications [2,3].

Eponymous names, structural locations of anatomical change, and biological functions of the associated genes create layers of complexity for rare genetic disorders, such as the corneal dystrophies, and this complexity widens the gap between the presentation of clinical phenotype in individual patients and an accurate diagnosis. Phenotypic complexity arises not just from the heterogeneity of different gene loci but also from an increasing number of different allelic forms of the known genes that influence the corneal dystrophies. Nevertheless, prevalence and expected incidence of new cases of genetically different corneal dystrophies are unknown because registries of affected cases have not been established and global rarity of the corneal dystrophies complicates their diagnosis if it is based solely on a clinical phenotypic impression. Most practitioners, except in specialty clinics, will only see new cases in genetically related individuals and, rarely, will they see a wide range of completely new and novel cases of different corneal dystrophies. However, rapid and accurate diagnosis is critical for appropriate patient management.

Genetic heterogeneity in the same type of corneal dystrophy may result from different allelic mutations in various regions of the same gene and defects in the same genomic region may lead to different types of corneal dystrophy, possibly through epigenetic events. One example is the mutations in the KRT3/KRT12 genes and alterations in the keratin protein heterodimers in Meesmann’s corneal dystrophy as discussed in our recent paper [1]. An extreme example might be the apparent absence of KRT3 and KRT12 mutations in several patients who were reported to have the clinical phenotype of Meesmann corneal dystrophy [4].

Another example of genetic and phenotypic heterogeneity is found with corneal dystrophies that are associated with the TGFBI (transforming growth factor, betainduced)- locus. A wide spectrum of TGFBI mutations and their clinical consequences have been investigated in corneal dystrophy patients in different ethnic populations [5].

Gene locus Gene name Chromosome location
KRT3 keratin 3 12q13.13
KRT12 keratin 12 17q21.2
TGFBI transforming growth factor, beta induced (keratoepithelin) 5q31
TACSTD2 tumor-associated calcium signal transducer 2 1p32
CHST6 carbohydrate (N-acetylglycosamine 6-O) sulfotransferase 6 16q22
GSN gelsolin 9q33
UBIAD1 UbiAprenyltransferase domain containing 1 1p36.22
DCN decorin 12q21.33
PIKFYVE phosphoinositide kinase, FYVE finger containing 2q34
COL8A2 collagen, type VIII, alpha 2 1p34.2 -p32.3
SLC4A11 solute carrier family 4, sodium borate transporter, member 11 20p13
ZEB1 zinc finger E-box binding homeobox 1 10p11.22

Table 1: Genes and chromosome locations associated with corneal dystrophy (names from HUGO Gene Nomenclature Committee).

The same mutation in TGFBI (e.g., Arg124His) may contribute to different subtypes of corneal dystrophy phenotypes, on the other hand, two distinct mutations of TGFBI (Arg124Ser and Arg555Trp) have been found to be responsible for the same subtype of corneal dystrophy, known as granular corneal dystrophy type 1 (GCD1) [6].

Here we report an in-depth analysis of corneal dystrophy in four-generation Chinese kindred, which had been clinically assessed with Meesmann-type corneal dystrophy, but for which there was no exon mutation in either the KRT3 or KRT12 gene [1]. If the clinical phenotype were, in fact, a variant of Meesmann corneal dystrophy, absence of a protein-coding mutation suggested that novel regulatory elements might be responsible for the clinical phenotype. However, before embarking on a search for potential regulatory elements in the genome, we screened the family for other corneal dystrophy related genes, beginning with the more polymorphic TGFBI. We found an Arg124Cysmutation in TGFBI that is the result of a C>T transition in all tested affected patients and, since this rare dominant-negative disorder is genetically heterogeneous in the Chinese population, we also mapped the geographic spectrum of known TGFBI mutations. This geographic spectrum was helpful to focus our attention on TGFBI and, therefore, we suggest that, in the absence of registries for these rare, phenotypically and genotypically heterogeneous disorders, the geographic distribution of allelic forms of the different corneal dystrophies might serve as a useful guide for future clinical genetic investigations of new cases by giving these rare traits a geographic context.

Methods

The Institutional Review Board of the Central Hospital, affiliated with Zhengzhou University, China, approved this study. All subjects or their parents provided written informed consent.

Patients

We studied a four-generation Chinese family including six living individuals with corneal dystrophy. The proband is a 20 year-old boy (IV-4) who was initially brought to hospital in Zhengzhou for evaluation of blurred vision, irritation, tearing and often photophobia. Visual acuity was normal (1.2 in both eyes). Multiple small cysts were seen with slit-lamp examination. His father (III-4) has a similar eye problem, which drew the family to clinical genetic attention. Subsequently, the extended four-generation family was assessed. Peripheral blood samples were obtained from patients II-2, II-3, III-4, III-6, III-12 and IV-4 and unaffected individuals III-1, -5, -7, -11, IV-2, -3, -5, -6 (including two non-genetic relatives III-5 and III-7).

exon 1 caggaggcctaagggacctactccatgctgcaaggttttt 607
exon 2        tcaattgcccatgtcaaagagccctgaaaaatgtctccaa 607
exon 3        ccagttggttggctgtaggtgaggagcagctcaggaaatg 514
exon 4 ccccagaggccatccctcctccgggcagacggaggtcatc 358
exon 5        ggcatgatgaatgggagtctgagaagcaggcacaaagagg 579
exon 6        tctccttgggccctctatttcaggggaacctgctctatg 416
exon 7 aggaagaggaaaggcaggttagcaacaggacaggatgacc 532
exon 8        agaaggcgaggaggatctggtcacaacccacacatttgc 527
exon 9        tgactgttcccctgatgacattttggttgagctgagtgga 434
exon 10      ttggcagcttcacttggtttttccttccttgtcagcaacc 409
exon 11      tcccagccttaataacccatccttttccccatcccaagtct 433
exon 12      tccagtggcctggactctacgatgtgccaactgtttgctg 337
exon 13      tgctttgtgtcctctgaccacatcctgggggtgagatatg 402
exon 14      ggcgacaagattgaaactcccccaattcactctgcaatca 405
exon 15 tgtgcattcacctttcttggagtgggagtggggagaagtt 406
exon 16 gtccacctgaaggcacacttccaagtcaccctgctgttct 393
exon 17 cacctgctatgtgcaggagaggctggattgcttgattcat 532

Table 2: Primers for PCR Amplification Direct Sequence of TGFBI gene.

DNA collection, isolation, amplification and sequencing

Genomic DNA was isolated from peripheral blood leukocytes by standard procedures using a blood DNA kit (Qiagen). The coding regions of the TGFBI genes were screened for mutations by direct sequencing using DNA amplified with primers (Table 2). Polymerase chain reaction (PCR) was performed at 94 °C for 5 min followed by 35 cycles at 94 °C for 30 s, 57 °C for 30 s, 72 °C for 30 s, and 72 °C for 5min. Primer sequences and annealing temperatures for each primer set are given in (Table 2). PCR products were examined on 1% agarose gels and then sequenced using an ABI PRISM 377 DNA sequencer (Applied Biosystems, Foster City, CA) and BigDye Termiantion cycle sequencing kit v. 3.1 (Applied Biosystems).

Results

The pedigree (Figure 1) shows eight affected individuals, all males, ranging in age from 20 (IV-4) to 80 (II-2) years; affected individuals I-1 and III-3 were identified from family description. Detailed clinical assessments were previously reported [1]. We note that vision was very poor in both eyes for individuals II-2, II-3, III-4, -6, and -12. Slitlamp examination of all affected living individuals showed multiple fine vesicles (microcysts) within the corneal epithelia in both eyes. In addition, two individuals (III-1 and IV-2) were clinically diagnosed with pathological myopia. The diagnosis was autosomal dominant, corneal dystrophy, Meesmann subtype, based purely on clinical impression from physical examination.

genetic-syndromes-gene-therapy-dominant-inheritance

Figure 1: Pedigree of a Chinese family with corneal dystrophy, showing autosomal dominant inheritance. Affected individuals have a solid symbol and proband (indicated by an arrow) is IV-4.

genetic-syndromes-gene-therapy-nucleotide-change

Figure 2: Sequencing analysis of PCR products from exon 4 of TGFBI in affected patients. The arrow indicates a nucleotide change in codon 124, which resulted in a change from wild type (CGC) to mutant (TGC) C>T, Arg124Cys.

Genomic DNA from peripheral blood leucocytes of affected living individuals (II-2, -3, III- 4, -6, -12, IV-4), unaffected individuals (III- 1, -11, IV-2, -3, -5, -6) and two nongenetic relatives (III-5 and III-7), was assessed for exon mutations in the TGFBI genes. The mutation of Arg 124 Cys at exon 4 of TGFBI was found. A heterozygous c 418 C>T transition mutation in exon 4 of TGFBI (Figure 2) was identified in all affected and tested individuals but not in unaffected family members. This mutation leads to a substitution at codon 124 (Arg124Cys, R124C) and is consistent with the literature on different subtypes of corneal dystrophy.

Discussion

The corneal dystrophy in this large Chinese pedigree was initially diagnosed as Meesmann epithelial corneal dystrophy, but no common KRT3 or KRT12 gene mutation was found with whole exome sequencing [1]. Either the clinical diagnosis was incorrect or some other gene is responsible for the autosomal dominant corneal dystrophy phenotype in this pedigree. Therefore, we started a search for mutations in other common genes that are associated with corneal dystrophy. We selected the TGFBI gene as a candidate for targeted whole exon sequencing. The TGFBI (chr5:135,364,584-135,399,507) comprises 17 exons and encodes a 68 kDa extracellular matrix protein (TGFBI keratoepithelin), which is expressed in the cornea and other tissues. TGFBI is an important disease gene related to different type of corneal dystrophy (Table 3) because disease-related mutations are very polymorphic. More than 50 mutations have been found in exon 4, 11, 12, 13 or 14 of TGFBI; however, two mutations in the TGFBI protein at Arg 124 and Arg 555 appear to be hotspots and account for >50% of all known TGBFI mutations. In our study, a nucleotide 418 C>T mutation in exon 4 of TGFBI (R124C) was identified and cosegregated with phenotype in all affected individuals and it was absent in unaffected individuals. This mutation leads to an amino acid substitution at codon 124 (R124C) (Figure 3). This pedigree is another example of classical Arg124Cyc TGFBI mutation reported in lattice corneal dystrophy according to International Committee Classification of Corneal Dystrophy (IC3D) [3].

In a broader sense, we also considered population-type questions, such as whether the same mutations of TGFBI gene share the same ancestry (co-ancestry), in other words they are transmitted by lineage, or they are independent spontaneous mutations. In order to address this question, haplotype analysis would have to be done with the families that shared the same mutations, but that would be beyond the scope of our study. In the meantime, we ask a more simple question of what is the geographic distributions of reported TGFBI mutations (including the present study) in the Chinese population. Interestingly, the profile of reported TGFBI mutations varies geographically and these mutations are associated with multiple subtypes of corneal dystrophy. It appears that patients from the south part of China tend to have TGFBI mutation at the 3’-end of the gene, while patients from the north part of China frequently have mutations at the 5’-end (exon 4) of TGFBI gene.

Patient origin TGFBI mutations in corneal dystrophy Subtype Reference
Gene/Exon Nucleotide Codon
China 4 418 G>A A124H RBCD [9]
[10]
12 1664G>C A555G
Taiwan 4 418G>T R124C LCD1 [11]
4 418G>A R124H GCD2
12 1646G>C A546D vLCD
12 1664G>A R555Q TBCD
12 1664G>T R555W GCD1
Korea 12 1580T>G L527R LCD 4 [12]
[13]
12 1620T>C F540F  
12 1664G>A R555Q TBCD
4 371G>A R124H GCD2
4 370C>T R124C LCD1
12 1580T>G L527R LCD2
12 1625C>G P542R LCD2
Poland 4 417C>T R124C LCD1 [14]
[15]
4 418G>A R124H GCD2
12 1711G>A R555Q TBCD
12 1710C>T R555W GCD1
14 1924A>G H626R vLCD
13 1694T>C L565P LCD
Japan     P501T LCD 3 [16]
Mexico 4 337G>A V113I aGCD [17]
11 1504A>G M502V unknown
12 1637C>A A546D PCA
12 1649T>C L550P GCD2
12 1663C>T R555W GCD1
14 1877A>G H626R LCD
America 14 1877A>G H626R LCD [18]
New Zealand 12 1664C>T R555W GCD1 [19]
14 1877A>C H626P CDB
Middle East 4 418G>A R124H ACD [20]
Italy 14 1892G>T V631N LCD [21]

Table 3: Review of geographic origins of TGFBI mutations in corneal dystrophy.

genetic-syndromes-gene-therapy-Chinese-population

Figure 3: Geographic distribution of TGFBI mutations in Chinese population. The spectrum of TGFBI mutations, as reported in literature [6,9,10, 22,23], is depicted on the geographical map. Yellow River, yellow dashed line; Yangchi River, blue dashed line.

How mutations in TGBFI mutations cause corneal dystrophy is still unknown. Several studies indicate various TGFBI mutations change the structural conformation of the TGFBI protein and disrupt protein-protein interaction, particularly the function of cell adhesion [7,8]. For example, the R555W mutant of the fourth fasciclin 1 (FAS1- 4) domain of the protein (TGFBIp/keratoepithelin/βig-h3), associated with granular corneal dystrophy type 1, is significantly less susceptible to proteolysis by thermolysin and trypsin than the normal or wildtype domain of the protein. Therefore, a functional hypothesis is that the R555W mutation may disrupt the normal degradation and turnover of the corneal TGFBI protein, leading to its accumulation and increased propensity to aggregate through electrostatic interactions [8]. In our pedigree, the initial diagnosis was based on phenotypic similarity to Meesmann epithelial corneal dystrophy, but it was without a KRT3 or KRT12 mutation [1]. Our discovery of the same TGFBI gene mutation (A124C) in all affected patients caused us to re-evaluate the clinical diagnosis that suggested GCD or LCD types of corneal dystrophy.

Acknowledgement

We thank all the families for their enthusiastic participation in this research and their consent for us to publish the results. This work was supported by The National Natural Science Foundation of China (grant No. 81171992), Program of Research Foundation from the Department of Science and Technology of Huaihua (2012-12) and Scientific Research Item Granted from the Education Department of Hunan Province (2015-982).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 10th International Conference on Genomics and Molecular Biology
    May 21-23, 2018 Barcelona, Spain
  • 5th International Conference on Human Genetics and Genetic Disorders September 21-22,2018 Philadelphia, USA Theme: Sharing Discoveries of the Future Human Genome
    September 21-22,2018 Philadelphia, USA
  • 3rd World Congress on Human Genetics & Genetic Disorders
    October 20-21, 2017 Toronto, Canada

Article Usage

  • Total views: 12102
  • [From(publication date):
    August-2015 - Nov 18, 2017]
  • Breakdown by view type
  • HTML page views : 8307
  • PDF downloads : 3795
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

materialsc[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords