Reach Us +1-947-333-4405
Blood Parasites in Camels (Camelus dromedarius) in Northern West Coast of Egypt | OMICS International
ISSN: 2155-9597
Journal of Bacteriology & Parasitology

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Blood Parasites in Camels (Camelus dromedarius) in Northern West Coast of Egypt

Tarek R Abou El-Naga1 and Safaa M Barghash2*

1Infectious Diseases Unit, Animal Health Department, Animal Production and Poultry Division, Desert Research Center, Cairo, Egypt

2Parasitology Unit, Animal Health Department, Animal Production and Poultry Division, Desert Research Center, Cairo, Egypt

*Corresponding Author:
Safaa M Barghash
Parasitology Unit, Animal Health Department
Animal Production and Poultry Division
Desert Research Center (DRC)
P.O. Box 11753, Cairo, Egypt
Tel: +202- 26332846
Fax: +20 226357858
E-mail: [email protected]

Received Date: November 27, 2015 Accepted Date: January 23, 2016 Published Date: January 26, 2016

Citation: El-Naga TRA, Barghash SM (2016) Blood Parasites in Camels (Camelus dromedarius) in Northern West Coast of Egypt. J Bacteriol Parasitol 7:258. doi: 10.4172/2155-9597.1000258

Copyright: © 2016 El-Naga TRA, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Bacteriology & Parasitology


An epidemiological study was conducted on the occurrence of blood parasitic infection in local camels in three selected sites representing Northern West Coastal zone of Egypt using Giemsa-stain blood smears (GSBS) and Polymerase chain reaction (PCR). This is the first molecular diagnosis report, which gives a picture of blood parasites covering this areas in Egypt. Results revealed that GSBS examination stopped at genus level on contrary to PCR techniques that detected and identified DNAs of blood parasites. Theileria was the most common pathogen (50.8%, 71.9%), followed by Anaplasma (47.4%, 67.37%), Trypanosoma (20.24%, 67.06%), and a lesser extent Babesia (11.8%, 18.43%) by GSBS and PCR, respectively. Mixed infections were present in 68.9%, with at least two hemoparasites belonged to different genus. Statistical analysis showed considerable variation in values within locations and age category reflected in a high significant (p<0.001), and both sexes were at risk of parasitic infections, particularly females. Only A. marginale caused anaplasmosis in 51 (22.9%) of infected dromedaries, while the majority were having A. marginale together with A. centrale 172 (77.13%). This is the first time to record B. bovis, B. bigemina, A. centrale and A. marginale in camels in this area. We concluded that blood parasites infection is highly prevalent in this area which strengthens the need to control programs help to prevent the spread of these parasites. The present results can serve as the basis for subsequent studies in dromedaries in Egypt; particularly Theileria genotype needs further studies.


Anaplasma; Theileria; Trypanosoma; Babesia; PCR; Camels; Egypt


Camel is an important multipurpose animal and since the old times, it has been used for transportation and produce milk, wool and meat in arid and semi-arid areas of the world [1]. Although camels are hardy animals and can tolerate the harsh conditions of arid regions because of their unique adaptive physiological characteristics, these animals face a wide variety of diseases [2,3]. Gastrointestinal and blood parasites are known to affect the health of camels leading to anemia, wasting and death in heavy infection [4].

Trypanosomiasis is the most important and serious pathogenic protozoal disease of camel caused by T. evansi infecting a wide range of animals throughout tropical and sub-tropical regions of the world [5-8]. Theileriosis is an important hemoparasitic disease of animals inducing a variety of clinical manifestations ranging from a subclinical presentation to a fatal disease depending, in part, on the animal species, host, age and the species of the microorganism. Tropical theileriosis caused by species of the genus Theileria has a wider distribution extending from North Africa to China [9]. Piroplasmids belonging to the genera Babesia are suspected of infecting dromedaries [10], but data published so far are limited [2,11]. The significant effect of Babesia infections are reported in domestic animals, humans, and some wildlife species. These tick-borne apicomplexan were generally considered as highly specific for a given host species [12].

Anaplasmosis is an arthropod borne disease of ruminants caused by species of the genus Anaplasma (Rickettsiales: Anaplasmataceae) [13]. Of the known Anaplasma spp., A. marginale is the most virulent, characterized by a progressive hemolytic anemia, and is responsible for extensive economic losses in tropical and subtropical areas [14-16]. On the other hand, A. centrale is capable of producing a moderate degree of anemia, but clinical outbreaks in the field are extremely rare. It is used as a live vaccine for cattle against the pathogenic A. marginale in tropical and subtropical areas [17]. A. marginale can be distinguished from A. centrale by the location and the characteristics of the inclusion bodies in the erythrocytes [18].

There has been a steady increase in the number of camels slaughtered for meat in Egypt. The camel’s ability to utilize the scanty fodder resources of the arid and semiarid zones for body maintenance, growth and milk production makes this animal a potentially important source of food [19]. There is paucity of information on hemoparasites of camels and their significance on health and productivity in northern west coastal zone of Egypt (the main camel rearing area). Camels are largely kept without close association with other carrier animals in this area. Biting flies (Stomoxys and Tabanus), and hard ticks were noticed on several locations at the camel’s body with large numbers; in particular Hyalomma dromedarii. No common use of a control program on a large scale is present. Molecular tools increasingly have become an integral part of studying the epidemiology of infectious agents. The current study was undertaken to verify the main blood parasites existing in dromedary Maghrabi camels in this area mainly by conventional PCRs.

Materials and Methods

Study design and study area

The present study was conducted on the occurrence of blood parasitic infection in local camels to detect and identify protozoan parasites, the etiological agents of trypanosomosis, theileriosis, babesiosis, and rickettsial anaplasmosis as being of economic importance. It was carried out during an epidemiological survey lasted from March 2012 to April 2015 within the frame of PROCAMED project, supported by the European Union (ENPI-Joint operational Programme of the Mediterranean Basin-IEVP-CT). For this purpose, 331 blood samples were collected randomly from local dromedary Maghrabi camels at different ages and both sexes. Diagnosis was performed primarily by Giemsa-stained blood smear (GSBS) and then analyzed mainly by different PCRs. Three sites in Matrouh governorate within the northern west coastal region of Egypt (NWC) between latitude; north 31°19- 26° 00 and longitude; 27° 45-28° 00 were selected (Figure 1).


Figure 1: Map of Egypt showing North western coast where blood samples were collected from camels reared in Matrouh Governorate. A (Sidi Barrany), B (El-Negeila), C (Mersa Matrouh): are the three selected sites where blood samples were collected.

Sample collection

Whole blood samples were collected from the jugular vein of each camel using clean sterile Vacutainer tubes containing ethylene di-amine tetra acetic acid (EDTA) for (a) microscopic examination and (b) DNA extraction as a target for PCR amplification. DNA samples were stored at –20°C until used. Cases of suspected trypanosomosis, theileriosis, anaplasmosis and babesiosis were investigated especially in Tabanus, Stomoxys and tick–infested camels with a fever, enlarged lymph nodes, anemia and jaundice, or hemoglobinuria due to Babesia.

Parasitological examination

Thin blood smears were prepared, air-dried, fixed in absolute methanol, stained with Giemsa-stain and examined microscopically for blood parasites with light microscopy (40X and oil immersion objectives) according to Hoare [20].

DNA extraction and PCR amplification

Genomic DNAs from 331 whole blood samples were extracted using The DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. All samples were subjected to PCR based assays to detect blood parasites using species-specific primers, the details of which are shown in Table 1. PCRs were conducted in a total volume of 25 μL composed of 12.5 μL of commercial Master Mix (Bio-basic, Portugal), 10 pmol of each primer, ~25 ng of genomic DNA and sterile water. Genomic DNAs isolated from the PCR reactions were performed in an automatic DNA thermocycler (Bio-Rad, Hercules, CA, USA) as follows: one cycle of 94°C for 4 min. (Pre-denaturation), followed by 30-40 cycles of 94°C for 1 min. (denaturation). Annealing temperature was 57°C for 1 min. for each of T. evansi, A. marginale, A. centrale, B. bigemina, B. bovis, and 52°C for 1 min. for each of T. brucei and Theileria sp. Different annealing temperatures ranged from 47°C to 59°C were performed for Theileria annulata. Polymerization step with a final extension was one cycle of 72°C for 5-7 min. PCR products were separated by 1.5% agarose gel electrophoresis to assess the presence of specific bands indicative of different blood parasites spp. [21-28].

Pathogen Nucleotide sequences of primers (Bp) Reference
Anaplasma marginale MAR1bB2F: 5′-GCT CTA GCA GGT TAT GCG TC-3′ and MAR1bB2R: 5′-CTG CTT GGG AGA ATG CAC CT-3′, were based on Major surface protein–1β encoding gen 265 [22]
Trypanosoma evansi TR3: 5′-GCGCGGATTCTTTGCAGACGA-3′  and TR4: 5′- TGC AGA CAC TGG AAT GTTACT-3', were derived from repetitive nucleotide sequences. 257 [23]
Babesia  bovis Bb1: 5′-TTTGGTATTTGTCTTGGTCAT -3′  and B. bovis Bb2: 5′- ACC ACT GTA GTC AAA CTCACC-3′, were derived from the sequence of the gene encoding the enzyme carbamoyl phosphate synthetase II. 446 [24]
Babesia bigemina Bg3: TAG TTG TAT TTC AGC CTC GCG and Bg4: AAC ATC CAA GCA GCT AHT TAG, were based on their small subunit ribosomal RNA sequences. 689 [25]
Theileria annulata In the case of T. annulata, the cytochrome b gene was selected and cytob1 primer set:  Forward: 5′-ACT TTG GCC GTA ATG TTA AAC–3′/Reverse: 5′-CTC TGG ACC AAC TGT TTGG–3′ was used to amplify a 312 bp variable region. 312 [26]
Theileria sp. 989:  5′-AGT TTCTGA CCT ATC AG–3′ and 990: 5′- TTG CCT TAA ACT TCC TTG–3′, were based on their small subunit ribosomal RNA sequences. 1100 [27]
Anaplasma marginale Am3: GTGGCAGACGGGTGAGTAATG A and Am4: CATGTCAAGAAGTGGTAAGGT, were derived from the sequence of the gene encoding the surface protein. 160 [27]
Trypanosoma brucei TBR1.2F: 5'-GAA TAT TAA ACA ATG CGC AG-3' and  TBR1.2R: 5?-CCA TTT ATT AGC TTT GTT GC-3' were based on the highly repeated sequence of mini-chromosome satellite DNA. 164 [28]

Table 1: Nucleotide sequences of species-specific primers were used for different blood parasites detection and their expected sizes.

Data analysis

Data management was performed using SPSS V20.0, (IBM SPSS Statics 20, USA). Data were summarized by descriptive statistics for mean and standard deviation. Comparisons among groups were evaluated using an analysis of variance (ANOVA) test. All statistics were considered significant at p ≤ 0.05.


Clinical examination

Field clinical examination to signs related blood parasites of 331 camels revealed 256 (77.34%) were asymptomatic and apparently healthy while 75 (22.66%) camels showing some clinical abnormalities varied in their manifestation from subclinical (52/75) to clinical (23/75) (Table 2). These include weakness, depression, rough coat, emaciation, atrophy of the hump and some camels remained in sterna recumbence. The reported clinical cases are mostly associated with the recrudescence of existing infections due to stress or with the introduction of native animals raised in tick free areas into tick-infested areas. Of the 256 asymptomatic camels, 98 (38.3%) and 232 (90.63%) were positive by GSBS and PCR respectively, where 24 (9.38%) were negative by either tests. None of the camel samples positive by GSBS were negative by PCR. All clinical and subclinical camels were positive by GSBS and PCR except for 5 camels were negative by microscopic examination.

Camels Clinical examination Blood Film PCR
No. % No. % No. %
Asymptomatic 256 77.34 98 38.3 232 90.63
Clinical 23 6.95 23 100.0 23 100.0
Sub-clinical 52 15.70 47 90.38 52 100.0
Total 331 168 50.75a 307 92.75b

Table 2:Detection of blood parasites in camels by microscopy and PCR based assay based on repetitive nucleotide sequences.

Parasitological findings

Initial diagnoses by GSBS do not meet our requirements and its ability stopped at genus level, revealing four genera of parasites including Trypanosoma, Theileria, Babesia and Anaplasma. Of the 331 camels were examined for presence of blood parasites, 168 (50.8%), 157 (47.4%), 67 (20.24%), and 39 (11.8%) were harboring theileriosis, anaplasmosis, trypanosomosis and babesiosis, respectively (Table 3). Anaplasma was detected in two forms in examined camels according to the location of the inclusion bodies in the erythrocytes, while Babesia had Pear shaped like and arranged in pairs with acute or wide angles near the margin of infected erythrocytes. Theileria were detected in erythrocytes in most cases and somewhat in schizont forms.

Parasite Blood smear (Frequency) PCR
Prevalence Parasite identification  (Frequency)
Trypanosoma 67 (20.24) 222 (67.06) 194 (58.61) T. evansi 28 (8.46) T. brucei
Anaplasma 157 (47.4) 223 (67.37) 51 (22.9) A.  marginale 172 (77.13)
  • marginaleA. centrale)
Theileria 168 (50.8) 238 (71.9) 238 (71.9) Th. camelensis 0 (0.0) Th. annulata
Babesia 39 (11.8) 61 (18.43) 34 (55.73) B. bovis 25 (40.9) B. bigemina

Table 3: Prevalence and identification of blood parasites in camels by Giemsa-stained blood smear and PCR based assay (n=331) .

PCR results

PCR was the powerful method used, not only when products were not detected in DNA free samples but also describe what Trypanosoma, Anaplasma, Theileria and Babesia subspecies present. Moreover, it allowed the accurate diagnosis of mixed infections which could not be detected by GSBS. Upon using their specific primers, the expected fragments of size 257 bp, 164 bp, 446 bp, and 689 bp were obtained from TR3/TR4 for T. evansi, TBR1/TBR2 for T. brucei, Bb1/ Bb2 for B. bovis and Bg3/Bg4 for B. bigemina, respectively (Figures 2a- 2c and 3). In the current study, two different species-specific primers were evaluated to detect A. marginale: Am3/Am4 amplified 160 bp as expected size, whereas MAR1bB2F/MAR1bB2R could not gave the expected fragment at 265 bp, but amplified strong fragments at 519 bp with mixed infections of A. marginale and A. centrale (Figure 2b). While, 989/990 the species-specific primer for Theileria detected fragments at 1100 bp, Cytob1F/Cytob1R evidenced the specificity of piroplasms infection in camels when failed to detect Th. annulata in this area (Figure 4). The presence and the percentage of blood parasites infection in Maghrabi camels in each of the three locations, both sexes and different ages are shown in Tables 2 and 3. PCR results revealed that the majorities of the detected infections were due to Theileria (71.9%), followed by Anaplasma (67.37%) and Trypanosoma (67.06%) with no significant difference, then Babesia (18.43%). The prevalence of these parasites was significantly varied between and within age groups, gender and origin of the animals (p<0.001), except for Theileria (p<0.05) (Tables 2-5). However, the higher incidence of the infected camels with protozoan parasites was found in Mersa Matrouh, the main entrance for camels from neighboring governorates, followed with slightly difference by El Negeila, and Sidi barrany that have a plenty of rains and plants than Mersa Matrouh (Table 4).


Figure 2 (a, b & c): Results of agarose (1.5%) gel electrophoresis of 164 bp of PCR-product for T. brucei (a), 519 bp of PCR-product for A. marginale together with A. centrale (b), and 160 bp of PCR-product for A. marginale only (c). Lane M, DNA molecular size marker (Qiagen, Germany).


Figure 3: Ethidium bromide-stained 1.5% agarose gel electrophoresis of PCR products, Lanes M, M contained 100-bp DNA marker (Qiagen, Germany). Lanes 1, 2 contained PCR products of B. bigemina from camels. Lanes from 3 to 8 correspond to positive PCR products of T. evansi. Lanes 9, 10 were PCR positive due to B. bovis.


Figure 4: Agarose gel electrophoresis of amplified DNA from different Theileria species at 1100 bp by using primer set 989/990. Lanes M, molecular size marker (Qiagen, Germany). Lanes from 2 to 5 correspond to positive PCR products of Theileria sp. Lanes 1, 6 represent positive and negative controls, respectively.

Prevalence Sex Age Location
Female Male X≤6 X≥12> 6 X< 12 Mersa Matrouh El Negeila Sidi Barrany
No. 241 90 152 84 95 138 73 120
T. evansi 162 (67.2) 32 (35.6) 81 (53.3) 64 (76.2) 49 (51.6) 108 (78.3) 36 (49.3) 50 (41.7)
T.  brucei 22 (9.13) 6 (6.7) 12 (7.9) 4 (4.8) 12 (12.6) 4 (2.9) 10 (13.7) 14 (11.7)
Anaplasma 152 (63.1) 71 (78.9) 105 (69.1) 63 (75) 55 (57.9) 108 (78.3) 53 (72.6) 62 (51.7)
Theileria 172 (71.4) 66 (73.3) 106 (69.7) 65 (77.4) 67 (70.5) 103 (74.6) 53 (72.6) 82 (68.3)
Babesia 47 (19.5) 14 (15.6) 47 (30.9) 4 (4.8) 10 (11.1) 44 (31.9) 13 (17.8) 4 (3.33)

Table 4: Prevalence of hemoparasites were detected in camels by PCR based on sex, age and site of collection (n=331).

  Sum of Squares df Mean Square F Sig.
Gender Between Groups 3.609 2 1.804 9.558 .000
Within Groups 61.920 328 .189    
Total 65.529 330      
Age Between Groups 17.059 2 8.530 12.710 .000
Within Groups 220.125 328 .671    
Total 237.184 330      
T. evansi Between Groups 9.405 2 4.702 21.756 .000
Within Groups 70.892 328 .216    
Total 80.296 330      
T. brucei Between Groups .751 2 .375 4.947 .008
Within Groups 24.881 328 .076    
Total 25.631 330      
Anaplasma Between Groups 4.796 2 2.398 11.572 .000
Within Groups 67.965 328 .207    
Total 72.761 330      
Theileria Between Groups .260 2 .130 .639 .528
Within Groups 66.610 328 .203    
Total 66.870 330      
Babesia Between Groups 5.236 2 2.618 19.286 .000
Within Groups 44.523 328 .136    
Total 49.758 330      

Table 5: Statistical analysis for blood parasites infections in camels based on PCR results.

Parasite-parasite interactions (Co-infections)

Infection with one type of disease agent can reduce or increase the incidence of infection with another. In this study, mixed infestation with different parasites from 2 to 4 in the same camel was common with a prevalence of 65.9%. The overall PCR rate of mixed infection was 25.7% for two parasites, 28.1% for three parasites and 12.1% for four parasites, while 26.9% of camels were harbored one parasite and 7.25% were free from examined blood parasites as representative in Table 6.

Prevalence Single infestation Mixed infestations Free
Two Three Four
No. 89 85 93 40 24
Frequency 26.9% 25.7% 28.1% 12.1% 7.25%

Table 6: Mixed infestations of  blood parasites were detected in camels by PCR.


Parasitic diseases have severely hindered development of livestock production in many Countries. Egypt is one of OIE Member Countries reporting blood parasitic diseases, trypanosomosis, theileriosis and babesiosis, of which trypanosomosis is the most widely distributed. The bulk of these diseases are caused by vector-borne Protozoa and Rickettsia. In the present study, camels are largely kept without close association with other carrier animals, such as cattle, sheep and goats. Consequently, transmission of blood parasites could take place at any time by biting flies and hard ticks which were noticed in large numbers; particularly H. dromedarii [8]. Females were-positive compared to males due to stress during gestation and milk production rendering them more susceptible to blood parasites infection [29,30]. Blood parasites infection was present in all age groups, but a group of 12 ≥ X<6 recorded the maximum rate of infection in all detected parasites (Table 3). This is due to owners and nomads prefer to graze their animals in open fields’ where they become more exposed to vector bites, and this age group had the most performance and activity. Furthermore, the distribution of blood parasites in the three sites of the study area reflected their characteristic. The effective diagnosis of parasitic infections requires highly sensitive and specific tests [31]. In many cases the identification of parasites concerns their epidemiology and it is important to distinguish between species and subspecies. Piroplasms occasionally occur in blood of carrier animals but in many cases they can’t be detected by direct examination, the diagnosis must be confirmed by detecting schizont [32]. Many authors did not clarify the incidence and the exact species of the blood parasite investigated camels [33]. PCR-based methods of detection have allowed prevalence data of parasites to be obtained with far greater accuracy than conventional microscopy and in some instances has taken over as the ‘gold standard’ for the diagnosis of parasitic infections [34].

In the present study, 60 out of 331 camels examined by GSBS, were positive for Trypanosoma (20.24%). Nearly the same rate of infection was recorded in 16.9% of local camels and 20.9% of imported camels from Sudan at Matrouh and Aswan governorates, respectively [8,35]. Lower rates were recorded in different countries from time to time viz., 3.5% in Nigeria [1], 5.7% in Egypt [31], and 4% in Kenya [36]. On the other hand, the prevalence of T. evansi by GSBS was 29.17 % at Darwa quarantine, Aswan, Egypt [37]. This variation in rates could be due to climatic variation, the diverse farming systems, abundance of vectors, and lack of health care and lack of veterinary services. Molecularly, PCR results showed that 222 out of 331 camels tested were having trypomastigotes 67.06% [194 (58.6%) T. evansi; 28 (12.6%) T. brucei], compared to a rate of 65.9% was recorded in the same area using RoTat1.2 amplified 205 bp [8]. Sex are likely to be risk factors for trypanosomiasis in camels in contrast to other blood parasites examined, however 162 out of 241 (67.2%) females and 32 out of 90 (35.6%) males were T. evansi-positive. This is coincides with two reported studies [8,38]. Those results were nearer to that previously recorded: 73.5% in Halaib, Shalateen and Abu-Ramad Triangle, 90% in Siwa Oasis and 46.7% in Maryout, Egypt [30]. In addition, our present study showed that where Mersa Matrouh recorded the highest rate of T. evansi infection 78.3%, Sidi Barrany the border area between Libya and Egypt recorded the highest rate of T. brucei infection evidencing the presence of T. brucei in Egypt in 22 (9.13%) females and 6 (6.7%) males. Based on the available information, the presence of T. brucei in Egypt was monitored for the first time [39], and the presence of mixed genotyping between T. evansi isolates with T. brucei in frontiers was discussed in detail [30,40].

Concerning theileriosis, it is considered to be the second most important haemoprotozoan disease following trypanosomosis affecting dromedary camels in tropical and subtropical countries [41]. In the present study, the parasite is thought to be transmitted by several species of ticks of the genus Hyalomma. However, a parallel study on tick-borne pathogens in camels (not published yet) by the same scientific team had confirmed Hyalomma species, the principal vector in the study area, has a big role in Theileria camelensis transmission among camel population. The current work indicated 50.8% of the examined camels by GSBS harbored Theileria with various developmental stages of different shapes and forms inside erythrocytes and schizont [42,43]. By using PCR assay, 71.9% of investigated camels were having theileriosis caused by Theileria sp. and the incidence of infection was 71.4% in females and 73.3% in males in agreement with those previously reported [44-47]. Higher and lower rates of Theileria camelensis ranged from 6.9% to 75% were recorded in Egypt by different authors [43,46-49]. In our opinion, these variations may be attributed to nature of the study area, climatic condition, diagnosis method and animal influences. Moreover, the specificity of piroplasms infection in camels has been achieved in the present study due to absence of Th. Annulata infection despite of presence in other ruminants in the study area [50]. This is in contrast to a study provided an evidence of low host specificity of piroplasmids and the possibility that dromedaries are capable of hosting other hostspecific piroplasms [45].

Regarding anaplasmosis, there is such dearth of research on camel anaplasmosis. A. marginale is considered capable of infecting dromedaries [51], and the occurrence of subclinical anaplasmosis was addressed in dromedaries’ camels [52]. In the present study, 47.4% of examined camels were harbored anaplasmosis by GSBS, while the overall infection rate recorded by PCR was 67.4% (223/ 331), of them, 78.9% and 63.1% were found in males and females, respectively. Anaplasma was detected in two forms belonging to A. marginale and A. centrale which were screened together in 172 (77.13%) of positive samples, wherever only A. marginale was detected in 51 (22.9%). These results were lower than those reported the presence of A. marginale in 83.8% and 95.5% of examined camels [51,53], respectively. A recent study in Nigeria showed the prevalence of hemoparasites in camels was 21.5%, Anaplasma sp. was the common hemoparasites seen in examined camels, and the infection was higher in females than males [54,55].

Few papers have reported Babesia sp. in camels; B. caballi was recorded for the first time in Sudanese camel [55], and the infection of Camelus dromedaries by Babesia was recorded in Egypt [47]. In the present study, 39/331 (11.8%) and 61/331 (18.43%) were harbored the infection with Babesia using GSBS and PCR-based assay respectively, and relatively low infections were recorded in 19.5% females and in 15.56% males. When Babesia positive samples identified by PCR-based assays, 36 (59.01%) and 25 (40.9%) of Babesia infection were found belong to B. bovis and B. bigemina, respectively. This means that we face problematic to cure these infected animals as they become carriers of the parasite and serve as reservoirs for transmission; in particular B. bovis is more dangerous than B. bigemina because it is less sensitive to some babesiacidal compounds [55]. These findings are contrary to previous studies that recorded an overall prevalence of 29% for Babesia, using PCR in Pakistan, whereby 11% were positive for B. bovis and 18% for B. bigemina [55]. In Nigeria, Babesia and Anaplasma species were the common hemoparasites seen in camels examined either singly or in combination, and more females (44.5%) than males (34.5%) were positive for various parasitic infections with no significant difference [54]. A recent study recorded an infection rate of 13.2% in camels in Saudi Arabia [2]. On the other hand, more recent study in Iran indicated 6.56% of camels were positive for Babesia spp. and the infection rate in males and females was 6.76% and 5.17%, respectively [56].

Combined data of blood parasites infection in our study revealed that 307 out of 331 examined camels were positive (92.7%), while 24 camels (7.25%) were free. Mixed infection was common in the same camel (65.9%), while 26.9% were having the infection with one parasite. A percentage of 25.7% and 28.1% were having 2 and 3 different parasites respectively, while 12.1% were infected with 4 different parasites. In our opinion, we suggest that the capacity to mount immune response against Theileria, Anaplasma and Babesia may be immunosuppressed in T. evansi infected camels in agreement with a study demonstrated that T. evansi infection lowers the immune-responsiveness of camels to concurrent immunizations [57].

In conclusion, it is the first time to expand our knowledge of the molecular epidemiology of parasitic infections in camels in this region except for Trypanosoma. Camels appeared to succumb to the infection with Theileria, Anaplasma and Trypanosoma with high rates. A. marginale and A. centrale were the main cause of anaplasmosis in dromedaries. This is the first report to show the presence of Babesia DNA in camels in this area. The source of infection of camels with A. marginale, B. bovis and B. bigemina might be as a result of animal movement to neighboring governorates. In addition to climates and tests, the vectors “particularly ticks” are of importance in transmission and disease management in this area. From the present study, it is clear that we face a big problem needed to reevaluated, especially the first infection with blood parasite may make the host more likely to acquire the second.


The authors gratefully acknowledge the financial support from the Desert Research Center (DRC). This study was partially funded by the European Union (ENPI-Joint operational Programme of the Mediterranean Basin -IEVP-CT), in the frame of PROCAMED project. This work was supported by Desert Research Center (DRC), Egypt. Authors would like to thank Mr. Esam A. Razin, Animal Health Department, DRC, Egypt for statistical analysis.


Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 10809
  • [From(publication date):
    specialissue-2016 - Oct 16, 2018]
  • Breakdown by view type
  • HTML page views : 10431
  • PDF downloads : 378

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Business & Management Journals


[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version