alexa Clinical and Environmental Prevalence and Antibiotic Susceptibility of Listeria monocytogenes in Dakahlea Governorate, Egypt | OMICS International
ISSN: 2327-5073
Clinical Microbiology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Clinical and Environmental Prevalence and Antibiotic Susceptibility of Listeria monocytogenes in Dakahlea Governorate, Egypt

Tarek El-Said El-Banna1, Fatma Ibrahim Sonbol1, Maysaa El-Sayed Zaki2, Heba Hassan Ibrahim El-Sayyad3*

1Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Tanta University

2Department of Clinical Pathology, Faculty of Medicine, Mansoura University

3Pharmacist, Specialized Medical Hospital, Mansoura University, Egypt

*Corresponding Author:
Heba Hassan Ibrahim El-Sayyad
Pharmacist
Specialized Medical Hospital
Mansoura University, Egypt
Tel: + 20 502254850
E-mail: [email protected]

Received date: April 23, 2016, Accepted date: May 26, 2016, Published date: June 06, 2016

Citation: El-Banna TES, Sonbol FI, Zaki MES (2016) Clinical and Environmental Prevalence and Antibiotic Susceptibility of Listeria monocytogenes in Dakahlea Governorate, Egypt. Clin Microbiol 5: 249. doi:10.4172/2327-5073.1000249

Copyright: © 2016 El-Banna TS, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Clinical Microbiology: Open Access

Abstract

Listeria monocytogenes (L monocytogenes) is a gram-positive bacterium with public health problem. A total of 870 samples were collected. These include of 470 clinical samples from ascites of end stage liver disease and gastric lavages of diseased infants (0.8-2 month old) as well as of 400 environmental samples taken from the market such as lettuce, carrot, ice cream, soft cheese, frozen meat, liver and hamburgers. They are collected during March 2010 and December 2014, from Dakahlea Governorate, Egypt. Listeria cultures were carried out, isolated, and investigated. Listeria colonies were recovered only in 50 (26 from patients and 24 from environmental) out of 870 samples and assessed by biochemical tests. Antibiotic susceptibility of L. monocytogenes to different 17 antibiotics was carried out. The Listeria isolates were appeared susceptible to amoxicillin/ clavulanate and cotrimoxazole and showed different resistance levels of chloramphenicol, ampicillin, streptomycin and tetracycline and were completely resistant to cefipime and ceftazidime. Using the iodometric overlay method of 50 Listeria isolates, 32 (64%) were blactamase( s) producers. Following PCR assessment of antimicrobial resistance genes, 28/50 L. monocytogenes isolates contained more one antimicrobial resistance gene sequence. A high frequency of penA (46%) was detected compared to strA (38%), tetM (20%), and ampC (18%). The authors finally concluded that although L. monocytogenes was detected in environmental and clinical samples at low rates, it exerted pathological symptoms and are susceptible to amoxicillin/ clavulanate and cotrimoxazole with a high frequency of antimicrobial resistant penA gene.

Keywords

Listeria monocytogenes; Ascites; Gastric aspirates; Environmental samples; Antibiotic resistance; Resistance genes

Introduction

Listeria currently includes a total of six species; L. monocytogenes , L. ivanovit , L. seeligeri , L. innocua , L. welshimeri and L. grayi . Of these species, L. monocytogenes and L. ivanovi are the only species found to be pathogenic to humans and other animals [1]. L. monocytogenes is food-borne pathogens contributed to the development of septicemia, meningitis, encephalitis and gastroenteritis, especially in infants, elderly and immunosuppressed individuals. It is also showed miscarriage in pregnant women [2]. It is detected in food stuffs such as vegetables, fruits, dairy products and some processed food items [3].

Some studies revealed that L. monocytogenes is susceptible to a wide range of antibiotics but resistant to cephalosporins and fosfomycin [4,5]. It is clearly evident that there is a difficulty in its treatment due to high resistance to antibiotics which may give risks to human health [6].

Identification of Listeria is difficult and need more time for investigation taking approximately 5-10 days in routine investigations [7], and these may interrupt the control of food safety. Recently, the applied molecular techniques represent promising alternatives tools for rapid identification. Polymerase chain reaction (PCR) facilitates rapid identification with of a high selective specificity and potential for automation [8].

The present study aimed to determine the incidence of Listerial infection and antimicrobial resistance profile of L. monocytogenes against several antimicrobials as well as the genotype profiles of the isolated L. monocytogenes in Egypt, using molecular biology tools.

Materials and Methods

Collection of human samples

Listerial infections were investigated in 270 of hospitalized infants (8 M old-2 Y- old) suffering from fever and vomiting during March and December 2010-2014 in Dakahlea Governorate, Egypt. The control study was conducted. Vomiting gastric fluids were collected from admitted infants. In case of patients with end liver disease, ascitic fluid was collected from 200 patients admitted at Mansoura University Hospital. Paracentesis was carried out without ultrasound guidance using a standard sterile technique. The clinical samples were delivered directly to the lab for investigations. A written informed consent had been taken beforehand from all patients or parent of infants.

Collection of environmental samples

Four hundred random samples of lettuce, carrot, ice cream, soft cheese, raw milk, frozen meat, liver and hamburgers, raw ground sausages and raw poultry were collected from the markets in Dakahlea Governorate. The samples were transferred directly in ice boxes to laboratory and analyzed for L. monocytogenes .

Enrichment procedures

The isolates were subjected for cold enrichment to allow increase growth of L. monocytogenes progeny. Subculture was performed after 24 hrs on Listeria selective agar (Oxford Formulation). Culture was further incubated at 37°C for 24 hrs and colonies were identified.

Biochemical confirmation techniques

Listeria isolates were tested for Gram stain; catalase reaction; motility test; blood haemolysis test and CAMP test according to Bergey’s Manual of Systematic Bacteriology [9].

Characterization of flagella by electron microscopy

L. monocytogenes cells were collected in pellets, fixed with glutaraldehyde 2% (volume in volume, v/v) in 50 mM sodium phosphate buffer pH 7.2 for 24 hrs, followed by negatively stained in 1% phosphotungstic acid for 10 seconds according to Hayat and Miller [10]. The grids were viewed with a Joel 100 CX transmission electron microscope.

Genomic DNA extraction

DNA was extracted from each isolate by using purification kit (Bio Basic DNA Mini Kit, Canada) as recommended by the manufacturer instructions

PCR identification of Listeria monocytogenes

Two primers were selected based on the prfA (transcriptional activator of the virulence factor) gene for L. monocytogenes according to Germini et al. [5]. The forward and reverse sequences were mentioned in Table 1. All PCR reactions were carried out using 25 µL containing 2 µL of extracted DNA. Each reaction mixture contained 12.5 µL Taq Master Mix (GenoOn, Germany), 1 µL of 500 M forward primer (LISF); 1 µL of 500 M reverse primer (LIS-R) and 8 µL of Ultra- Pure DNase/RNase-Free distilled water (Fermentas, USA). The DNA amplification reactions were carried out in thermal cycler (Techne, UK) as follows: pre-incubation at 95°C for 5 min; 40 cycles consisting of ds DNA denaturation at 95°C for 30 s, primer annealing at 54°C for 30 s, primer extension at 72 °C for 30 s; final elongation at 72 °C for 5 min.

Target gene Primer sequence (5’-3’) Amplified fragment length Reference
prfA gene LIS-F: TCA TCG ACG GCA ACC TCG G 217 bp Germini et al. [5]
  LIS-R: TGA GCA ACG TAT CCT CCA GAG T    

Table 1: Primer used for identification of L. monocytogenes by PCR.

Gel electrophoresis

All amplification products were carried out in 1.5 % agarose gel, stained with ethidium bromide, under a short-wavelength UV light source, and photographed. A standard 100 bp DNA ladder (GenoOn, Germany) was used to determine the size of the amplified fragments. Escherichia coli ATCC 25922 as standard for Gram negative.

Phenotypic detection of antimicrobial resistance in L. monocytogenes isolates

Antimicrobial susceptibility test was performed of each isolate by a disc diffusion method on Mueller-Hinton agar according to Bauer et al. [11]. The tested antimicrobial discs (Oxoid, England) were ampicillin (AMP/10 µg), amoxicillin (AMX/25 µg), ampicillin/ clavulanate (AMC/30 µg), cefotaxime (CTX/30 µg), ceftriaxon (CRO/30 µg), ceftazidime (CAZ/30 µg), cefepime (FEB/30 µg), amikacin (AK/30 µg), gentamicin (CN/10 µg), streptomycin (S/10 µg), erythromycin (E/15 µg), ciprofloxacin (CIP/5 µg), norfloxacin (NOR, 30 µg), chloramphenicol(C/30 µg), sulphamethazole/trimethoprim (SXT/25 µg), tetracycline (TE/30 µg), vancomycin (VA/30 µg).

Detection of ß-lactamase production

Each of the positive tested isolates was applied onto the surface of nutrient agar plates. After overnight incubation at 37°C, the plates were overlaid with 1% molten agarose containing 0.2% soluble starch, 1% penicillin G and 0.2% toluene. The plates were incubated for 15 min at room temperature and thin homogenous film of iodine solution was done onto the surface of the agar plates and incubated at room temperature until discoloration zones appeared around ß-lactamase producing colonies [12].

PCR reaction and condition of antimicrobial resistance genes

Nine antimicrobial resistance genes were tested such as encoding tetracycline efflux pump (tetA and tetM ), streptomycin phosphotransferases (strA and strB ), penicillin binding protein gene (penA ), chloramphenicol transporter non-enzymatic chloramphenicol-resistance protein (cmlA ), adenine methylase related to resistance of erythromycin (ermA ), erythromycin resistance methylase (ermB ) and beta lactamase–ampicillin resistance gene (ampC ). Oligonucleotide sequences and amplicon sizes of antimicrobial resistance genes were illustrated in Table 2. The antimicrobial resistance genes were determined by PCR technique according to Srinivasan et al. [13]. Primers were supplied from Integrated DNA Technologies (Bilolegio, Netherlands). Amplification of target genes was performed using a DNA thermal cycler (Techne, UK). And the Taq polymerase kit (GenoOn, Germany) in 0.5 mL of 96-well PCR plates (Fisher Scientific Co., Pittsburgh, PA). The reaction mixture (50 µL total volume) consisted of 30 µL of sterile water, 5 µL of PCR buffer (100 mM Tris-HCl (pH 8.3), 500 mM KCl), 2 L of 15 mM MgCl2, 2 µL of deoxyribonucleoside triphosphates (2.5 mM each dATP, dTTP, dGTP and dCTP), 1.0 µL of each primer (stock concentration, 25 µM), 1–10 µL of template, and 0.5 µL (5 U/µL) of Taq DNA polymerase. After overlaying with sterile seal tape (Fermentas, USA), samples were subjected to PCR amplification. Thirty PCR cycles were run under the following conditions: denaturation at 94°C for 45 sec, primer annealing at optimum temperature for 45 sec, and DNA extension at 72°C for 45. PCR tubes were incubated for 7 min at 72°C and then at 4°C. Twenty µL of the reaction mixture were analyzed by standard agarose (1.5%) gel electrophoresis (Cambrex Bio Science, Rockland, ME) with Trisborate- EDTA buffer system. Reaction products were visualized by staining with ethidium bromide (0.5 µg/mL in the running buffer). Escherichia coli ATCC 25922 as standard for Gram negative.

Target gene Primer Sequence (5’-3’) Amplicon size (bp) Reference
  tet A Fw 5’GGCCTCAATTTCCTGACG   372 Guillame et al.[14]
Rv 5’AAGCAGGATGTAGCCTGTGC
  tet M Fw 5’GTGGACAAAGGTACAACGAG   405 Poyart-Salmeron et al. [15]
Rv 5’-CGGTAAAGTTCGTCACACAC
  str A Fw 5’-CTTGGTGATAACGGCAATTC   548 Gebreyes andAltier [16]
Rv 5’-CCAATCGCAGATAGAAGGC
  str B Fw 5’-ATCGTCAAGGGATTGAAACC   509 Gebreyes and Altier [16]
Rv 5’-GGATCGTAGAACATATTGGC
  erm B Fw 5’-GAAAAGGTACTCAACCAAATA   639 Okamoto et al. [17]
Rv 5’- AGTAACGGTACTTAAATTGTTTAC
  erm A Fw 5’- AACACCCTGAACCCAAGGGACG   420 Sutcliffe et al. [18]
Rv 5’-CTTCACATCCGGATTCGCTCGA
  cml A Fw 5’-CCGCCACGGTGTTGTTGTTATC   698 Gebreyes and Altier[16]
Rv 5’- CACCTTGCCTGCCCATCATTAG
  pen A Fw 5’-ATCGAACAGGCGACGATGTC   500 Antignac et al. [19]
Rv 5’-GATTAAGACGGTGTTTACGG
  amp c Fw 5’-TTCTATCAAMACTGGCARCC   550 Lanz et al. [20]
Rv 5’-CCYTTTTATGTACCCAYGA

Table 2: Primers used for detection of genes encoding resistance to different antimicrobials in L. monocytogenes isolates.

Results and Discussion

Occurrence of L. monocytogenes

Fifty samples (5.74%)/870 tested clinical and environmental samples exhibited the presence of L. monocytogenes (Table 3). These include 26 (52%) for clinical and 24 (48%) of the environmental ones.

Type of sample No. & % of samples No. & % of isolated L. monocytogenes
Peritoneal fluids 200 (22.9%) 15 (30%)
Gastric aspirate 270 (31%) 11(22%)
Lettuce 42 (4.8%) 2 (4%)
Carrot 49 (5.6%) 3(6%)
ice cream 39 (4.4%) 0
soft cheese 62(11.6%) 6 (!2%)
Frozen meat, live.hamburgers 40(7.1%) 0
Raw poultry 55 (6.3%) 5(!0%)
Ground raw sausages 53(6%) 3(6%)
Raw milk 60(6.8%) 5(10%)
Total 870(100%) 50(5.74%)

Table 3: L. monocytogenes assessments in clinical and environmental samples.

Biochemical & PCR techniques

The positive clinical and environmental isolates showed positive catalase test, beta-haemolysis, umbrella-shaped motility motility test and positive CAMP test. Applying forward and reverse prfA (transcriptional activator of the virulence factor) gene detected 217 bp. PCR amplification gives all amplicons Figure 1.

clinical-microbiology-Agarose-gel-showing-PCR

Figure 1: Agarose gel showing PCR amplicons of prfA gene amplicons (217bp). Lane M 100 bp DNA ladder. Lanes L1-L8 is amplified products of tested isolates. NC, negative control.

Antibiotics susceptibility

Table 4 summarized the activities of 17 antibiotics tested against the 50 L. monocytogenes isolated from the clinical and environmental samples. Amoxicillin-clavulanate showed highest sensitivity reaching to 86% of the tested isolates. However, high rates of resistance were observed for streptomycin (90%), cefotaxime (94%), ceftriaxone (96%) and ceftazidime and cefipime (100%), while low rate of resistance was remarked to chloramphenicol (18%), vancomycin and cotrimoxazole (24%), and tetracycline (26%).

Antimicrobial agent (μg/disc) Resistance Sensitive
Ampicillin 28 (56%) 22 (44%)
Amoxicillin 37 (74%) 13 (26%)
Amoxicillin-calvulanate 7 (14%) 43 (86%)
Cefotaxime 47 (94%) 3 (6%)
Ceftazidime 50 (100%) 0
Ceftrioxne 48 (96%) 2 (4%)
Cefipime 50 (100%) 0
Streptomycin 45 (90%) 5 (10%)
Gentamycin 24 (48%) 26 (52%)
Amikacin 23 (46%) 27 (54%)
Erythromycin 15 (30%) 35 (70%)
Ciprofloxacin 30 (60%) 20 (40%)
Norfloxacin 42 (84%) 8 (16%)
Chloramphenicol 9 (18%) 41 (82%)
Ctrimoxazole 12 (24%) 38 (76%)
Tetracycline 13 (26%) 37 (74%)
Vancomycin 12 (24%) 38 (76%)

Table 4: Number and percentages of antimicrobial susceptibility pattern of tested isolates of L. monocytogenes.

Ultrastructural characterization of L. monocytogenes flagella

L. monocytogenes appeared rod-shaped structures with many flagella distributed in a peritrichous manner with many points of attachment (Figure 2).

clinical-microbiology-Electron-micrograph-L-monocytogenes

Figure 2: Electron micrograph of L. monocytogenes with negative stain showing rod-shaped structure with pattern of flagellar formations.

Prevalence of ß-lactamase production

ß-lactamase production was detected in 32 (64%) / 50 Listeria isolates. The rate of production of ß-lactamase was higher in environmental samples compared to the clinical one Table 5.

No. of L.monocytogenes isolates No. & % of ß-lactamase producers
Clinical isolates 26 14 (53%)
Non clinical isolats 24 18 (75%)
Total L.monocytogenes isolates 50 32 (64%)

Table 5: Production of ß-lactamase enzymes by tested L.monocytogenes isolates.

Occurrence of antimicrobial resistance genes tetM , tetA , strA and strB genes

Twenty eight of 50 L. monocytogenes isolates (56%) possessed more than one antimicrobial resistance gene. A higher incidence of antimicrobial resistance genes was observed in environmental samples (55%), compared to the clinical ones (45%). A highest incidence of antimicrobial resistance genes were recorded for the tetracycline resistance genes, tetM and tetA which reached respectively to 77% and 53.8%.

Chloramphenicol-resistant cmlA gene reached to 22%. The streptomycin-resistant genes reached to 42 and 17% respectively for strA and strB . The average percentages of erythromycin resistant genes ermA and ermB attained to 20 and 30 % respectively of the 15 erythromycin resistant isolates. Also penA and ampC resistant genes were detected in 46% and 18% of the resistant isolates Table 6 and Figures 3-8.

Antibiotic resistance gene No. of L. monocytogenes isolates No &% of resistant genes of L.monocytogenes isolates
tet M 13 10 (20%)
tet A 13 7 (14%)
cml A 9 2 (4%)
erm A 15 3 (6%)
erm B 15 5 (10%)
amp C 50 9 (18%)
pen A 50 23 (46%)
str A 45 19 (38%)
str B 45 8 (16%)

Table 6: Prevalence rate of antimicrobial resistance genes in L. monocytogenes isolates.

clinical-microbiology-PCR-amplicons-antimicrobial-resistant

Figure 3: Agarose gel showing PCR amplicons of antimicrobial resistant gene of tetM gene of representative L.monocytogenes isolates (lanes 1,3,4,5,2 & 6), M: 100 pb molecular marker and lane Nc is negative control.

clinical-microbiology-Agarose-gel-cml-tet

Figure 4: Agarose gel showing PCR amplicons of antimicrobial resistant gene of the cml & tet A gene of representative L. monocytogenes isolates (lanes 1,4,5,18,3,6 &8), M: 100 pb molecular marker and lane NC is negative control.

clinical-microbiology-tet-gene-representative-isolates

Figure 5: Agarose gel showing PCR amplicons of antimicrobial resistant gene of the cml & tet A gene of representative L. monocytogenes isolates (lanes 9,19,29,12 &48), M: 100 pb molecular marker and lane Nc is negative control.

clinical-microbiology-molecular-marker-lane-NC

Figure 6: Agarose gel showing PCR amplicons of antimicrobial resistant gene of the erm B & erm A gene of representative L. monocytogenes isolates (lanes1, 2,3,4,5,7), M: 100 pb molecular marker and lane NC is negative control.

clinical-microbiology-Agarose-gel-str-pen

Figure 7: Agarose gel showing PCR amplicons of antimicrobial resistant gene of the str A & pen A genes of representative L. monocytogenes isolates (lanes 47,48,49 &50), M: 100 pb molecular marker. Lane NC, negative control.

clinical-microbiology-Agarose-gel-amp-str

Figure 8: Agarose gel showing PCR amplicons of antimicrobial resistant gene of the amp C & str B genes of representative L. monocytogenes isolates (lanes 8-14), M: 100 pb molecular marker and lane NC is negative control.

Discussion

In the present study, the incidence rate of L. monocytogenes reached to 50/870 (5.74%) and varied markedly between clinical and environmental samples. In clincal samples the rate of listerial infection in ascitic fluid attained to 15/200 (7.5%) compared to 11/270 (4%) in gastric lavages of diseased infants. These findings supported the work by Zaki et al. [21], whom reported increased rate of L. monocytogenes in ascitic fluid of cirrhotic patients to 24.4%. Toyoshima et al. [22] reported two cases L. monocytogenes related to peritonitis in cirrhotic patients. Concerning infants, there was no reported incidence of Listeriosis, however Mokta et al. [23] reported Listeriosis in a two-dayold full term male baby with fever, skin rash, gastritis and vomiting. Listeriosis was found to be increased in patients with physiologic and pathologic defects related to immune diseases [24].

Furthermore, 24/400 (6%) infection rate of Listeria were detected in environmental samples. These include 6/62 (9.6%) of soft cheese and 5/60 (8.3%) of raw milk. Similar finding was reported in soft cheese [25,26] and raw milk [27]. The prevalence of L. monoctogenes in raw milk attained to 21.7% in Iran [28] and 6.3% in Ireland [29].

Also, the observed findings showed rates of listerial infection in carrot being 3/49 (6.1%) and 2/42 (4.7%) in lettuce. Similar findings were reported by Ieren et al. [30] whom reported L. monocytogenes infection in 1/50(2%) of carrot and 3/49(6.2%) in lettuce. Ding et al. [31]. Detected that the incidence of L. monocytogenes infection ranged from 11.9 to 17.4 cases per million persons in Korea and considered lettuce as the most contaminated vegetables. These infections may result from contamination during harvesting during human handling, equipment’s, transport containers, wild and domestic animals [32].

The present data reported 5/55 (9%) L. monocytogenes isolates from raw poultry (egg shells) and this agreed with Sayed et al. [33] and Shaker et al. [34] whom reported similar rates which may result from contamination or listerial infection [35].

Furthermore, the observed findings revealed the presence of listerial infection at 3/53 (5.6%) in raw sausage raw sausage samples, Similar results were reported by Yucel et al. [36] and Ennaji et al. [37]. Nonetheless, the presence of L. monocytogenes in processed meats is a more serious public health issue because the organism can often grow in products having extended shelf-lives during refrigerated storage and reach levels that facilitate the establishment of invasive infections. Problems of infection may arise from subsequent cross-contamination that occurs through using raw materials, by humans, rodents, insects and even birds. Listerial infection in infants seemed to be a result of cross-contamination from the uncooked vegetables as well as from soft cheese made from raw milk is the possible source of Listeria infection [38].

Analyzing the PCR Profiles of the 50 L. monocytogenes isolates using forward and reverse virulence associated gene prfA exhibited detection of 217 bp region. Similar findings were achieved in Iran [39] and India [40] following assessments of the prfA gene in L. monocytogenes isolates recovered from the food stuffs.

Following assessments of antimicrobial sensitivity of 17 antibiotics toward environmental and clinical isolates, resistance of the isolates was detected against ampicillin, amoxicillin, aminoglycosides and flouroquinolones. The present findings supported the work of ALAshmawy et al. [27] and Odjadjare et al. [41]

According to Srinivasan et al. [13], all the L. monocytogenes isolates were susceptible to gentamicin. Also, combination of amoxicillin with a B-lactamase inhibitor, calvulinic acid reduced the incidence of resistance by 14%.

Furthermore, all the isolates showed a high resistance toward the third generation cephalosporins and completely resistant to the fourth generation cephalosporins cefepime. The present findings agree with the work of Ennaji et al. [37].

As a result of the weak activity or complete resistance of the second and third generation cephalosporins against L. monocytogenes , Cormican and Jones [42] confirmed that it is not used clinically for treating listeriosis.

Also, 30% and 34% of L. monocytogenes isolates appeared resistant to erythromycin and tetracycline and the resistance rate reached to 24% for vancomycin and cotrimoxazole however it decreased to 18% for chloramphenicol. Although Odjadjare et al. [41] reported similar findings; Srinivasan et al. [13] mentioned a higher resistance rate reaching approximately to 100% for cotrimoxazole, erythromycin and vancomycin and to 32% for chloramphenicol.

Following B-Lactamase screening test, 32/50 Listeria isolates were B-lactamase producers compared to 18 negative isolates. This confirmed that ampicillin is the drug of choice for listeriosis. Resistance of L. monocytogenes to antimicrobials is due to production of enzyme like b-lactamases, which are chromosomally encoded or most often plasmid mediated [43].

Also, the present findings revealed that the listerial isolates exhibited average incidence of antimicrobial genes of tetM, tetA, strA and strB . These findings were similar to Jamali et al. [44] and contradicted with Srinivasan et al. [13] who reported that 34% of the isolates carried strA and missing of the other streptomycin resistance genes (strB and aadA ).

In addition, screening of 15 erythromycin resistant isolates, 3 (20%) and 5 (33%) of isolates contained ermA and ermB genes respectively. These findings agree with the work of Morvan et al. [45] who found ermB gene in three erythromycin-resistant strains. However, Odjadjare et al. [41] did not detect ermA and ermB in 19 erythromycin resistant isolates.

Although, the B-lactams showed the highest phenotypic resistance, the detected genes responsible for resistance to these antibiotics were not equally detected in the Listeria isolates. The ampC and penA resistance genes were detected in 9 (18%) and 21 (42%) of the Blactams resistant isolates, respectively. These findings agree with the work of Jamali et al. [44] and Srinivasan et al. [13] whom observed incidence resistance rates of 71.4% and 37% of the isolates containing penA gene respectively.

The authors concluded that due to high resistance rate to ampicillin, it should be used in combination with gentamicin to insure synergistic activity against listrosis and so ampicillin plus gentamicin is often recommended for therapy while sulfamethoxazole-trimethoprim is recommended for secondary prophylaxis.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8630
  • [From(publication date):
    June-2016 - May 22, 2018]
  • Breakdown by view type
  • HTML page views : 8481
  • PDF downloads : 149
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7