alexa Clinical Variability among Patients with Gilbert Syndrome | OMICS International
ISSN-2155-9929
Journal of Molecular Biomarkers & Diagnosis

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Clinical Variability among Patients with Gilbert Syndrome

Leila Chaouch1*, Imen Darragi2, Emna Barkaoui1, Slim Ben Ammar1, Dorra Chaouachi1, Imen Boudrigua1and Salem Abbes1

1University of Tunis El Manar, Pasteur of Molecular and Cellular Hematology Institute of Tunis, Laboratory, Tunis, Tunisia

2University of Tunis El Manar, Hospital of Traumatology and Great Brulés, Department of Biochemistry, Ben Arous, Tunisia

*Corresponding Author:
Leila Chaouch
Pasteur of Molecular and Cellular
Hematology Institute of Tunis, Tunisia
Tel: 71.873.366
Fax: 71.872.055
E-mail: [email protected]

Received Date: September 29, 2014; Accepted Date: October 31, 2014; Published Date: November 03, 2014

Citation: Chaouch L, Darragi I, Barkaoui E, Ammar SB, Chaouachi D, et al. (2014) Clinical Variability among Patients with Gilbert Syndrome. J Mol Biomark Diagn 6:201. doi:10.4172/2155-9929.1000201

Copyright: © 2014 Chaouch L, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Molecular Biomarkers & Diagnosis

Abstract

Introduction: Gilbert syndrome (GS) is due to a defect in uridine diphosphate glucuronosyl transferase (UGT1A1) gene and belongs to the group of the most common human metabolic disorders and is characterized by an elevated level of bilirubin in blood serum. Genotyping functional polymorphisms in UGT1A1 gene is an important step in the determination of the etiology of free hyperbilirubinemia of unknown origin. Herein, we aimed to explain the genetic profile and the clinical variability of this disease in Tunisian patients.

Material and methods: We explored a total of 30 subjects including 7 unrelated isolated cases and 23 subjects distributed to 7 families. The exploration of these subjects included the genotyping of two Functional polymorphisms of UGT1A1 gene associated with GS namely: A(TA)nTAA and G71R, the bilirubin level, the hematological parameters, the determination of glucose-6-phosphate dehydrogenase activity (G6PD) and echo dense images within the gall bladder with acoustic shadowing or gravitational change in position.

Results: The exploration of the hematological parameters showed that all subjects enrolled in this study are out of hemolytic disease with the exception of two individuals, it is a father and his son who have a profile of a β thalassemia minor. The exploration of G6PD activity showed that all patients presented normal values. All patients presented hyperbilirubinemia among whom some patients presented benign asymptomatic jaundice, two patients presented kernicterus and 4 patients presented cholelithiasis. The genetic profile studied of UGT1A1 revealed that the mutant allele A of the G71R polymorphism was absent for all subjects and that the genotype (TA)7/(TA)7 was associated with hyperbilirubinemia and with GS.

Introduction: Gilbert syndrome (GS) is due to a defect in uridine diphosphate glucuronosyl transferase (UGT1A1) gene and belongs to the group of the most common human metabolic disorders and is characterized by an elevated level of bilirubin in blood serum. Genotyping functional polymorphisms in UGT1A1 gene is an important step in the determination of the etiology of free hyperbilirubinemia of unknown origin. Herein, we aimed to explain the genetic profile and the clinical variability of this disease in Tunisian patients.

Material and methods: We explored a total of 30 subjects including 7 unrelated isolated cases and 23 subjects distributed to 7 families. The exploration of these subjects included the genotyping of two Functional polymorphisms of UGT1A1 gene associated with GS namely: A(TA)nTAA and G71R, the bilirubin level, the hematological parameters, the determination of glucose-6-phosphate dehydrogenase activity (G6PD) and echo dense images within the gall bladder with acoustic shadowing or gravitational change in position.

Results: The exploration of the hematological parameters showed that all subjects enrolled in this study are out of hemolytic disease with the exception of two individuals, it is a father and his son who have a profile of a β thalassemia minor. The exploration of G6PD activity showed that all patients presented normal values. All patients presented hyperbilirubinemia among whom some patients presented benign asymptomatic jaundice, two patients presented kernicterus and 4 patients presented cholelithiasis. The genetic profile studied of UGT1A1 revealed that the mutant allele A of the G71R polymorphism was absent for all subjects and that the genotype (TA)7/(TA)7 was associated with hyperbilirubinemia and with GS.

Keywords

Gilbert syndrome; UGT1A1 polymorphism; Clinical variability

Abbreviations

GS: Gilbert Syndrome; G6PD: Glucose-6-phosphate Dehydrogenase; SCA: Sickle Cell Anemia; UGT1A1: Uridine Diphosphate Glucuronosyl Transferase

Introduction

The protein produced from the UGT1A1 gene, called the bilirubin uridine diphosphate glucuronosyl transferase, is the only enzyme that glucuronidates bilirubin (bilirubin-UGT). This enzyme converts the toxic form of bilirubin (unconjugated bilirubin) to its nontoxic form (conjugated bilirubin), making it able to be dissolved and removed from the body [1]. The bilirubin-UGT enzyme is primarily found in cells of the liver, where bilirubin glucuronidation takes place. Conjugated bilirubin is dissolved in bile, a fluid produced in the liver, and excreted with solid waste [2]. Changes in the UGT1A1 gene can cause GS. This condition is characterized by periods of mild unconjugated hyperbilirubinemia, which rarely leads to episodes of jaundice [3-6]. GS occurs worldwide, but some mutations are seen more often in particular populations. In many populations, the most common genetic change that causes Gilbert syndrome occurs in an area near the UGT1A1 gene called the promoter region, which controls the production of the bilirubin-UGT enzyme. This change must occur in both copies of the UGT1A1 gene to cause GS. The common genetic change involved in GS, called UGT1A1*28, results from the addition of two DNA building blocks (nucleotides) to an important sequence in the promoter region known as the TATA box [7,8]. The normal UGT1A1 TATA box sequence is written as A(TA)6TAA [6]. Moreover, three mutant allelic forms exist depending on the number of (TA): UGT1A1*36 (n=5), UGT1A1*28 (n=7) and UGT1A1*37 (n=8). The UGT1A1*28 change, however, is uncommon in Asian populations. Asians with GS often have a mutation in one copy of the UGT1A1 gene that results in the change of a single protein building block (amino acid) in the bilirubin-UGT enzyme. The most common mutation in this population is a restriction polymorphism at exon 1 G211A replaces the amino acid glycine with the amino acid arginine at position 71 of the enzyme (written as Gly71Arg or G71R) (5). This type of mutation, known as a missense mutation, results in reduced enzyme function. People with Gilbert syndrome have approximately 30 percent of normal bilirubin-UGT enzyme function [9,10]. As a result, unconjugated bilirubin is not glucuronidated quickly enough, and it builds up in the body, causing mild hyperbilirubinemia. Symptoms can range from clinical jaundice to nausea, malaise and discomfort in the right hypochondrium or even abdominal pain.

In a previous studies we have reported the implication of the gilbert mutation in cholelithiasis among patients without hemolytic disease and among patients with sickle cell anemia [11,12]. Our findings have been similar to further studies which have been reported the role of gilbert mutation in cholelithiasis.

Herein, we aimed to determinate the genetic profile of GS among Tunisian patients and to discuss the clinical variability going of the asymptomatic in kernicterus.

Material and Methods

Materials

We explored a total of 30 subjects including 7 unrelated isolated cases and 23 subjects distributed to 7 families with persistent indirect hyperbilirubinemia serum bilirubin levels and diagnosed as affected by gilbert syndrome. Table 1 summarizes the main characteristics of the studied population.

  Patients with jaundice Patients without jaundice p
Number 17 13  
Age (range) 2-45 3-45 NS
Sex ratio (M/F) 12/5 7/6 NS
Hb (g/dl) 12.3 ± 0.9 12.9 ± 1.3 NS
RBC (1012/L) 4.89 ± 1.02 4.29 ± 0.9 NS
MCV (fl) 74.2 ± 1.3 79.7 ± 0.9 NS
MCH (pg) 35.7 ± 1.02 34.9 ± 2.1 NS
RDW (%) 5.29 ± 1.02 4.83 ± 0.5 NS
HbA 97 97 NS
HbA2 3 ± 0.1 3 ± 0.2 NS
G6PD values (U/gHb) 6.86 ± 1.01 6.54 ± 0.9 NS
Total bilirubin level (µmol/l) 90 ± 45 20 ± 2 0.01
Unconjugated bilirubin level (µmol/l) 70 ± 10 ± 2.2 0.006
Conjugated bilirubin level (µmol/l) 20 ± 10 ± 1.8 0.04
Cholelithiasis 2 0 0.05
Kernicterus 3 0 0.045

Table 1: Repartition of hematological and demographic and clinical data according to the presence or the absence of jaundice

Methods

For each patient we explored different parameters including:

Definition of clinical events, hematological data, hemoglobin profile, biochemical parameters, G6PD dosage and genotyping of UGT1A1 polymorphism.

Definition of clinical events

Cholelithiasis was diagnosed on the basis of echodense images within the gall bladder with acoustic shadowing or gravitational change in position. Kernicterus was diagnosed on the basis of MRI and physical examinations.

Laboratory methods

After consent of each patient venous blood samples of 2.5 ml volume were drawn from the study subjects and were collected in K2-EDTA anticoagulant containers. The complete blood counts including counts of red blood cells (RBC), white blood cells (WBC), and the measurement of hemoglobin (Hb), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and red cell distribution width (RDW) were performed using a an automated cell counter (ABX pentra 60c+). Diagnosis of hemoglobinopathy was performed using cation-exchange high performance liquid chromatography (HPLC) (D10 Biorad) Total unconjugated and conjugated bilirubin concentrations were determined in serum by a standardized colorimetric procedure using automate Konelab 20. The determination of G6PD activity was performed using spectrophotometric method as described by Bendaoud et al. [13].

A(TA)nTAA and G71R genotyping

After consent, 10 ml of EDTA blood were collected from each volunteer. The DNA was extracted by the standard phenol / chloroform method from peripheral blood leukocytes. We used PCR / sequencing for the study of microsatellite polymorphism A(TA)nTAA and G71R. The PCR reaction was performed in a reaction volume of 25 μl containing 150 ng of genomic DNA, 0.2 mM dNTP, 5 pmol of each primer {(TA) F: TAACTTGGTGTATCGATTGGT and (TA) R: CTTTGCTCCTGCCAGAGGTT}, 1 unit of Taq DNA polymerase (Invitrogen, 5 U/µl) and 2.5 μl of 10X PCR buffer in the presence of 1 µl of 50 mM of MgCl2. PCR products were purified by the enzymatic method with exonuclease I and Shrimp Alkaline Phosphatase (SAP) and subsequently sequenced using an automated sequencer (310 DNA sequencer ABIPRISM PE Applied Biosystems, Foster City, United States).

Statistical analysis

The demographic and hematologic data are normally distributed, so we used means and standard deviations. The bilirubin data are not normally distributed, so we used medians. The two polymorphisms studied were tested for deviation from the Hardy-Weinberg equilibrium using the software package Arlequin (version 3.01). Chi Square test or fisher test was used to determine genetic differences between patients using compare 2(version 1.02)

Results

As for the hemoglobin exploration the results show that all individuals implicated in this study have a normal hemoglobin profile (HbA with a percentage equal to 97%, HbA2 with a percentage equal to 3%). With the exception of two subjects, it is a father and his son who have a profile of a β thalassemia minor: HbA with a percentage equal to 94%, HbA2 with a percentage equal to 6%. This phenotype was confirmed by molecular study of β globin gene (data not shown). These two individuals have the mutation C/T codon39 in the heterozygous state. The G6PD assay revealed normal values for all individuals studied. The hematological analysis based on complete blood counts (CBC) (revealed that all individuals have normal hematological parameters except for two individuals who have thalassemia microcytosis. Biochemical analysis showed that the values of total bilirubin ranging from 10 μM to 246 μM. Knowing that the maximum limit of the normal values of total bilirubin corresponds to 17 μM, our sample was classified into two groups according to two ranges of values of total bilirubin: the first includes the following values A: (10 μM-17 μM), the second corresponds to the following values B: (17 μM – 246 μM). The 13 non-icteric individuals are classified in the interval A. 17 jaundiced individuals are classified in the interval B.

The exploration of the polymorphism A(TA)nTAA revealed the presence of five genotypes. In our sample we counted four individuals (TA)6/(TA)6 (normal genotype), 1 (TA)6/(TA)5, 1 (TA)5/(TA)7, 14 (TA)6/(TA)7 and 10 (TA)7/(TA)7 (genotype associated with Gilbert's syndrome). Genotypic comparison between patients in the two intervals of total bilirubin showed a statistically significant association between genotype (TA)7/(TA)7 and hyperbilirubinemia. In addition, patients who have the genotype (TA)7/(TA)7 have variable depending on the extent of jaundice hyperbilirubinemia.

The genotypic and allelic comparison between patients according to the presence or absence of jaundice showed a statistically significant association between genotype (TA)7/(TA)7and jaundice. Among patients with jaundice 2 have nuclear jaundice and 3 have cholelithiasis.

The exploration of genetic profile of A(TA)nTAA among the members of families included in this study shows that patients with (TA)7/(TA)7 inherited from parents with TA7 allele at homozygous or heterozygous state (Figure 1).

molecular-biomarkers-diagnosis-polymorphism

Figure 1: Genotypes according to A(TA)nTAA polymorphism of families studied.

Interestingly, the exploration of the polymorphism G71R showed that the mutant allele A was absent among all subjects.

Discussion

Polymorphism A(TA)nTAA has been explored in different populations indicating its association with hyperbilirubinemia [14,15] and the appearance of pigment stones [16-18]. In the Tunisian population we have been reported previously that subjects carrying (TA)7 or (TA)8 variant in their genotypes are associated with high bilirubin level and with cholelithiasis [11,12]. Furthermore, the comparison between patients and controls according to A(TA)nTAA variation demonstrated that (TA)6/(TA)7 and (TA)7/(TA)7 genotype and (TA)7 and (TA)8 alleles were significantly associated with an increased risk of gallstone diseases p=0.0017, p= 6.1 10-6, p=1.5 10-6 and p=0.025 respectively [5] (Tables 2 and 3).

A(TA)nTAA genotypes A B p
(TA)6/(TA)5 1 0 -
(TA)5/(TA)7 1 0 -
(TA)6/(TA)6 4 0 1*
(TA)6/(TA)7 7 5 0.082
(TA)7/(TA)7 0 12 10-3
Total 13 17  

Table 2: Repartition of different genotypes depending two intervals representing bilirubin level.

  Absence  Presence  p
(TA)6/(TA)6 4 0 1*
(TA)6/(TA)5 1 0 1
(TA)5/(TA)7 1 0 1
(TA)6/(TA)7 9 5 0.119
(TA)7/(TA)7 0 12 10-3

Table 3: Repartition of different genotypes depending the presence or the absence of jaundice.

We also performed all clinical laboratory tests ordered that we considered relevant to evaluating whether hemolysis contributed to the hyperbilirubinemia. Our results showed that all patients included in this study are out of hemolytic disease. The G6PD assay revealed normal values for all individuals studied. Of the 30 subjects studied 17 had hyperbilirubinemia and jaundice, 13 presented normal values of bilirubin. Among patients with jaundice 2 have nuclear jaundice and 3 have cholelithiasis. As for the genetic profile of UGT1A1 polymorphisms studied, our results show the association of (TA)7/(TA)7with hyperbilirubinemia, Jaundice, cholelithiasis and kernectirus. The exploration of G71R polymorphism showed the absence of mutant allele in the studied sample. The homozygous (TA)7/(TA)7 has a meaning because of its relationship to the onset of Gilbert. Indeed, 17% of Gilbert's disease appears to be associated with a homozygous (TA)7 in various populations: Caucasian, African American, and Japanese [19-23]. In asian population the GS is associated with G71R [9].

In conclusion, Gilbert's disease appears to be associated with a homozygous (TA)7 in Tunisian population. Moreover, Levels of bilirubin in GS patients are reported to be from 20 μM to 90 μM. Patients with high bilirubin can develop choelithiasis at early age and it can cause kernicterus in absence of treatment at time.

It is well known that most children with kernicterus have no underlying etiology identified to explain the hyperbilirubinemia. In fact, preventing a case of kernicterus might be one of the most valuable strategies in all of healthcare, resulting in a healthy baby rather than a child with a life-time of debilitating neurodevelopment handicaps.

Acknowledgement

This article has been financially supported by the Ministry of Higher Education and Scientific Research of Tunisia (LR 05 SP 04).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 12026
  • [From(publication date):
    December-2014 - Jul 20, 2018]
  • Breakdown by view type
  • HTML page views : 8231
  • PDF downloads : 3795
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7