alexa Cloning and Expression of the Pathogenicity-Related Genes of Oidium heveae in the Infection Process | OMICS International
ISSN: 2157-7471
Journal of Plant Pathology & Microbiology

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Cloning and Expression of the Pathogenicity-Related Genes of Oidium heveae in the Infection Process

Yaqi Sun1, Peng Liang1, Qiguang He1, Wenbo Liu1, Rong Di1,2, Weiguo Miao1* and Fucong Zheng1*

1Hainan Key Laboratory for Sustainable Utilization of Tropical Bioresource/College of Environment and Plant Protection, Hainan University, Haikou 570228, China

2Department of Plant Biology, Rutgers, the State University of New Jersey, New Brunswick, New Jersey 08901, USA

*Corresponding Author:
Weiguo Miao and Fucong Zheng
College of Environment
and Plant Protection
Hainan University, Haikou
Hainan, China
Tel: +86-0898-662-70229
Fax: +86-0898-661-92915
E-mail: [email protected],[email protected]

Received date: March 18, 2015 Accepted date: June 15, 2015 Published date: June 25, 2015

Citation: Sun Y, Liang P, He Q, Liu W, Di R, et al. (2015) Cloning and Expression of the Pathogenicity-Related Genes of Oidium heveae in the Infection Process. J Plant Pathol Microbiol S1:001. doi:10.4172/2157-7471.S1-001

Copyright: © 2015 Sun Y, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Plant Pathology & Microbiology

Abstract

Oidium heveae B.A. Steinmann is a biotrophic fungus that infects rubber tree and causes powdery mildew disease, resulting in significant annual rubber yield losses worldwide. Researches on O. heveae in China had been limited on the cytological observation for the interaction of O. heveae with rubber tree, and the environment factors, such as temperature on the disease development. There had been scarce research on the infection mechanism of this important fungal pathogen at the molecular level. Pathogenicity-related genes of O. heveae are important for us to understand its infection process, which can potentially become targets for disease control. We have characterized eleven pathogenicity-related genes of O. heveae by genomics and transcriptomic studies. Four genes are involved in fungal metabolism, and the other three are related to fungal growth. Four genes were found to encode hypothetical proteins. The expression of these genes was further studied by qRT-PCR. Our results indicated that the expression of the metabolism-related Oh-PC2 gene encoding phosphoenolpyruvate carboxykinase (PEPCK) was up-regulated at 3 dpi (day post infection). Our data also demonstrated that at 3 dpi during the hyphae formation stage, the expression of all three fungal growth-related genes Oh-AAA-peroxin, Oh-RNP and Oh-Imp was up-regulated. Additionally, the expression of at least three O. heveae genes encoding hypothetical proteins was shown to increase at 3 dpi. Our results have provided novel insight to understanding the molecular mechanisms of O. heveae pathogenicity during its infection of rubber tree

Keywords

Oidium heveae; Rubber tree powdery mildew; Pathogenicity-related genes; qRT-PCR

Introduction

Oidium heveae B. A. Steinmann infects rubber tree and causes powdery mildew, a worldwide disease in the rubber tree belt. O. heveae infection results in serious damage on the growth of rubber trees and significant economic loss in the rubber production. Cool and humid weather is favorable for powdery mildew disease outbreak on rubber trees. O. heveae is an obligate parasitic (biotrophic) fungus occurring on the leaf surface of rubber trees. The identification and classification of this fungus are still uncertain because there is no authoritative report of its morphology and no record of its teleomorphic stage [1,2].

The powdery mildew fungus O. heveae of rubber tree damages rubber tree leaves, buds, shoots and inflorescence. It causes repeated infection on leaves throughout the year with conidial spores. Presently, the main disease control measures rely on new pesticides and resistant varieties [3]. In China, the studies of O. heveae have been limited to the cytology observation on the interaction of O. heveae with rubber tree, including the infection and development process and environmental factors such as temperature [4,5]. O. heveae is an obligate parasite, it cannot be cultured on medium [6]. There is very little known about the genes involved in its infection process [7].

Pathogenicity-related genes are important during pathogen infection process. They are involved in establishing the parasitic relationship with plant and undermining the normal physiological function of plant genes. They regulate a series of pathological processes, such as plant tropism, adsorption, invasion, colonization, expansion and destruction of the host [8]. At the early infection stage, conidiospores of O. heveae land on the leaf surface, similar to all powdery mildew fungi. The conidia started to form the germ tube and then form the appressoria. After forming an appressoria it began to penetrate the host and the haustoria develop within the cell, signaling a successful infection. After successful infection, the secondary hyphae continue branching out and spreading on the host surface. At last,the conidiophores are formed at the top of the stalk, finishing a full infection cycle [9]. This process is consisted of the initial, latent and post-infection periods.

Digital gene expression (DGE) tag profiling has been used to study the pathogenicity-related genes of Magnaporthe oryzae, the rice blast causal agent, which is the primary model system for elucidating various aspects of host plant-fungal pathogen interaction [10-12]. DGE method uses data of relative tag frequencies to show gene expression differences [13]. Transcriptomic analysis has also been used to study pathogenicity-related genes [5]. Yeonyee Oh et al. [5] reported the first comprehensive genome-wide transcript profile and the functional analysis of infection structure formation of Magnaporthe oryzae. Gene knockout and complementary strategies have also been used to study the function of pathogenicity-related genes [14]. SMART (Switching Mechanism At 5’ end of the RNA Transcript) technology was used to construct normalized cDNA library from wheat powdery mildew (Blumeria graminis f. sp. Tritici) spores to study its gene function [15].

We have analyzed our transcriptome and genome data (unpublished) of O. heveae to search for the pathogenicity-related genes. We have identified 25 pathogenicity-related genes, from which 11 genes were selected based on the functions of their homologous proteins in other fungi. These 11 genes were cloned and were found to belong to three categories, the metabolism- and growth-related genes, and genes encoding hypothetical proteins [5]. The expression of these genes during different infection stages was further analyzed by qRTPCR and compared to the transcriptomic data. This study has provided unprecedented insights to the pathogenicity-related genes of O. heveae during infection and disease development stages. This research is a basical work for the further function study of O. heveae.

Materials and Methods

Strains of Oidium heveae

Oidium heveae B.A.Steinmann strain HO-73 was collected from the rubber tree forest in Danzhou, Hainan. It was isolated by the “single spot” [16] method from rubber tree and deposited in the Molecular Plants Pathological Laboratory of the Environment and Plant Protection College in Hainan University. O. heveae HO-73 was inoculated onto cultivar Reyan 7-33-97 for the continuous passage culture (Table 1).

Gene name Description Identity (%) Fungi P-value
Oh-EKA EKA-like protein 88 Blumeria graminis 5e-32
Oh-G protein beta subunit/AC1 G-protein beta subunit 97 Blumeria graminis 0.0
Oh-GAP GTPase-activating protein 64 Blumeria graminis 2e-31
Oh-PC2 phosphoenolpyruvate carboxykinase 60 Magnaporthe grisea 7e-29
Oh-AAA-peroxin Reveals unique evolution of an obligate biotroph 64 Blumeria graminis 5e-117
Oh-RNP retrotransposon nucleocapsid protein 44 Metarhizium anisopliae 5e-103
Oh-Imp spore germination 56 Blumeria graminis 5e-91
Hypothetical protein-1 hypothetical protein 47 Pyrenophora teres 4e-13
Hypothetical protein-2 hypothetical protein 39 Penicillium digitatum 5e-12
Hypothetical protein-3 hypothetical protein 66 Penicillium digitatum 9e-05
Hypothetical protein-4 hypothetical protein 76 Blumeria graminis 1e-31

Table 1: The function and identity of amino acid of pathogenicity-related genes. The homologous genes of Oidium heveae by Blast.

RNA sample preparation and cDNA synthesis

Total RNA was extracted from Oidium heveae at four infection stages, 0, 1, 3 and 30 dpi (day post infection), using Trizol (Life Technologies, Carlsbad, CA, USA) (Wan et al., [11]). The corresponding cDNA was generated by reverse transcription with the RevertAid First Stand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., USA).

Gene ontology and functional annotation

Due to the lack of information on the functions of O. heveae genes, we used GO (Gene Ontology, http://geneontology.org/) to predict the functions of O. heveae genes related to pathogenicity. GO has been successfully used to provide structured, functional annotation of the rice blast pathogen Magnaporthe oryzae [11].

Cloning the O. heveae pathogenicity-related genes

Degenerate primers were designed with the software Primer Premier 5.0. The primers in Table 2 were used to amplify 11 of the pathogenicity-related genes from O. heveae DNA. Reaction conditions were as follows: 94°C 4 min; 94°C 1 min, 50°C 30 sec, 72°C 30 sec, for 30 cycles; 72°C 7 min. The reaction system was as follows: Forword/ Reverse Primer 1 μl; DNA 2 μl; ddH2O 6.5 μl; Mix 9.5 μl.

Gene Forward primer Reverse primer
Oh-GAP TCGTTGTCCTCCTCGGTAG AAGCGTGCTGAGAAATGG
Oh-G protein beta TGTCTTGATACTCGTCCTGTCGG TATAGATGGAGCTCAGTTGCGGC
Oh-PC2 TGTGGAAACTTCACGGACTA CATCAAGGCTTGCAGGAG
Oh-RNP CCACTCCACCCAGTCATC ATCAACAACTTGGCACCC
Oh-EKA AGGAAGTATGGGAGGTATGGACAA CAGCGTTCCCGGCTTTATTGTCT
Oh-AAA-peroxin TGCCCGAACGCTATACCAACCAT CCGCCAACATCACTCCAACTTACAT
Oh-Imp TGTCTTGATACTCGTCCTGTCGG TATAGATGGAGCTCAGTTGCGGC
Hypothetical1 protein-1 TTGAAGACCTGGTGTAAGC TGGAACATAGACGAGCA
Hypothetical2 222protein-2 TGATGCCTAAACTCTTGT CTAAGTCTCCAGGGTAAT
Hypothetical3 3protein-3 ATGGGTTCCTTGAGTCGG TTGAAGCGTTTGGTCTGG
Hypothetical4 protein-4 protein-1ppproproteinprotein CAACGAAATCACGAAGAAGAATTG TTGCCGGGAGAGAAGATGAGAAC

Table 2: Sequences of cloning primers used in this study. The cloning primers of the pathogenicity-related genes of Oidium heveae.

The expression profile of O. heveae pathogenicity-related genes

RNA was extracted from O. heveae at four infection stages. Quantitative RT-PCR (qRT-PCR) was used to quantify the expression levels of pathogenicity-related genes with ABI 7500 (Applied Biosystems, Foster City, CA, USA) and SYBR○RR Premix TaqTM kit (Takara, Japan). The primers are shown in Table 3. 18s rRNA gene was selected as the internal reference. Reaction conditions were as follows: 95°C 30 sec; 95°C 5 sec, 55°C 30 sec, 72°C 30 sec, 40 cycles.

Gene Forward primer Reverse primer
18s AAGCAAGCCTACGCTCTGG GCTCCACCAACTAAGAACGG
Oh-GAP CCTTACACTCTTTTGCCTTCC GCCGTTGCATCATCCTTT
Oh-G protein beta TCGGGCTAACAGAAATGCG GCTAAGGGAAAAGCGAGAAAG
Oh-PC2 TACTTTGCCCTCAGCCTTCG TGCCTTGGGATCAGCGTC
Oh-RNP ACAGGGGCTGCCAAGAAG CCAATCCTCCCGTAGAAGTAGA
Oh-EKA AGGAAGTATGGGAGGTATGGACAA CAGCGTTCCCGGCTTTATTGTCT
Oh-AAA-peroxin CCAGCACTGTGGCTATCACT CCCCAAGGCTCGACTAAC
Hypothetical protein-1 TTCCAACCAACCATCACC GACCCCTATAATCCATCCAC
Hypothetical protein-2 2protein-2 CTGAGCTTAAATAACCACCCC GTCCAAGTAACTACTATCCGTCCT
Hypothetical protein-3 CTTCTGCCCGTGAGTTATGC GAGACTGCGAATCCCTGATC
Hypothetical protein-4 CAACGAAATCACGAAGAAGAATTG TTGCCGGGAGAGAAGATGAGAACA

Table 3: Sequences of quantitative RT-PCR primer used in this study. The quantitative RT-PCR primers of the pathogenicity-related genes of Oidium heveae.

Results

Identification of eleven pathogenicity-related genes

The genomic sequences of O. heveae (our unpublished data) were uploaded to the online software DAVID to confirm the GO categories. Those sequences that Received the GO number of 0009405 were identified as pathogenesis-related sequences. Our unpublished transcriptomic data demonstrated that some O. heveae genes were highly expressed at the peak (3 dpi) of the initial infection. Totally 11 genes were selected for further study. These genes were classified into three categories. The metabolism-related genes including Oh-EKA, Oh-G protein beta subunit/AC1, Oh-Gap and Oh-PC2 are involved in phosphorylation, kinase activity and amino acid metabolism during the host invasion. The growth-related genes including Oh-AAA peroxin, Oh-RNP and Oh-Imp are associated with the pathogen growth and development in the host, such as the formation of appressorium. Four other pathogenicity-related genes encode hypothetical proteins. The sequences of these 11 genes were used in the NCBI BLAST analysis to compare with other pathogenic fungi. The BLAST results confirmed that these 11 O. heveae sequences were homologous to the pathogenicity-related genes of other pathogenic fungi (Table 1).

Cloning the O. heveae pathogenicity-related genes

Based on the GO and BLAST analyses of these 11 genes, primers were designed (Table 2) and used to amplify parts of these 11 pathogenicity-related genes by PCR using the O. heveae DNA as the template. Partial cDNAs were obtained with lengths ranging from 250 to 1000 bp (Figure 1). All cDNAs were sequence-confirmed to be identical to the genomic data of O. heveae.

plant-pathology-microbiology-Cloning-primer-sequences

Figure 1: Cloning primer sequences used in this study. Cloning of O. heveae pathogenicity genes by PCR. 1. Oh-EKA; 2. Oh-G protein beta subunit/AC1; 3. Oh-GAP; 4. Oh-PC2; 5. GOh-AAA-peroxin; 6. Oh-RNP; 7. Oh-Imp; 8. Hypothetical protein-1; 9. Hypothetical protein-2; 10. Hypothetical protein-3; 11. Hypothetical protein-4.

Expression analysis of the O. heveae pathogenicity-related genes by qRT-PCR and comparison to the transcriptomic data

The expression of the 11 pathogenicity-related genes of O. heveae at different infection stages (0, 1, 3 and 30 dpi) was analyzed by qRT-PCR (Figure 2). For the four genes involved in the metabolism pathway, we found that the expression of Oh (O. heveae)-EKA and Oh-GAP was not up-regulated at 1, 3 and 30 dpi (Figure 2A). This qRT-PCR result was confirmed by our transcriptomic data (Figure 2B). The expression of Oh-G protein beta subunit/AC1 gene increased only slightly by 1.05- fold at 3 dpi (Figure 2A). The expression of Oh-PC2 gene, however, increased significantly by 15.79-fold at 3 dpi (Figure 2A). Although the expression of Oh-PC2 decreased slightly at 30 dpi, it was still as high as 13.53-fold (Figure 2A). The transcriptomic analysis seemed to show that Oh-PC2’s expression increased at 3 dpi and decreased at 30 dpi (Figure 2B), but as a much lower level compared to the qRT-PCR result. This discrepancy could be due to the measurement error in the transcriptomic analysis, as it was performed only once. Out of these four genes, only Oh-PC2 seemed to be highly up-regulated during O. heveae infection of rubber tree, indicating its significance in the metabolism of O. heveae.

plant-pathology-microbiology-metabolism-related-genes

Figure 2: The relative expression of pathogenicity-related genes of O. heveae at different infection stages. (A) RT-qPCR analysis of metabolism-related genes; (B) transcriptomic data of metabolism-related genes; (C) RT-qPCR analysis of fungal growth-related genes; (D) transcriptomic data of fungal growth-related genes; (E) RT-qPCR analysis of hypothetical protein genes; (F) transcriptomic data of hypothetical protein genes.

For the O. heveae genes related to growth (Figure 2C), the expression of Oh-AAA-peroxin gene increased to 6.62-fold at 3 dpi compared to 0 dpi (Figure 2C) and then decreased at 30 dpi. The Oh-RNP gene expression level increased to 7.65-fold at 3 dpi and then dropped to 3.43-fold at 30 dpi (Figure 2C), compared to its level at 0 dpi. The Oh- Imp gene expression increased quickly to 4.0-fold at 1 dpi, decreased to 2.83-fold at 3 dpi and continued to decline at 30 dpi. The expression trend of these three fungal growth-related genes as analyzed by qRTPCR was similar to our data in the transcriptomic analysis (Figure 2D). Day 3 is the mycelium growth period post infection for O. heveae, the up-regulation of Oh-AAA-eproxin, Oh-RNP and Oh-Imp gene expression underlines their importance for mycelium development.

Figure 2E shows that the gene expression of hypothetical protein-1, hypothetical protein-2 and hypothetical protein-3 increased to 4.32- , 3.79- and 27.69-fold at 3 dpi. This result was confirmed by our transcriptomic data, however at different scales (Figure 2F). For the Ohhypothetical protein-4, although the qRT-PCR analysis did not show any gene expression changes at the infection stages, the transcriptomic data seemed to indicate a 7-fold increase at 3 dpi (Figure 2F).

Discussion

Prior to this study, little information is available on the gene functions of O. heveae. Genes responsible for the developmental stages of O. heveae had never been studied by the transcriptomic analysis. Transcriptome analysis at the early stage of infection has been done using ESTs and SAGE technology for some fungi, e.g. Magnaporthe oryzae [17]. In this work, we identified 11 O. heveae pathogenicityrelated genes through bioinformatic analysis of our genomic data (unpublished). We have also conducted transcriptomic analysis of O. heveae at 0, 1, 3 and 30 dpi (unpublished). When these 11 genes were analyzed for their expression levels at the same infection stages by qRT-PCR, we found our results were mostly similar to our O. heveae transcriptomic data (Figure 2).

We identified six out of eleven O. heveae genes that are homologous to those of Blumeria graminis, the barley powdery mildew causal agent (Table 1). They are Oh-EKA, Oh-G protein beta subunit/AC1, Oh- GAP, Oh-AAA-peroxin, Oh-Imp and the hypothetical protein-4. Both M. oryzae (the rice blast causal agent) and Blumeria graminis (the wheat powdery mildew causal agent) are obligatory parasitic fungi as O. heveae. Both B. graminis and O. heveae belong to Erysiphaceae. The expression patterns of O. heveae genes in the metabolism pathway and growth were similar to those in M. oryzae [11]. The fungal metabolism pathway-related genes especially those encoding protein kinase and phosphatase are important for growth, reproduction, information transmission and intrusion of the host [18]. The Oh-EKA is homologous with the EKA-like protein of B. graminis, with a role in genome expansion and gene loss in powdery mildew fungi [18,19]. The Oh-G protein beta subunit/AC1 is reported to have an effect on the appressorium formation in M. oryzae [20]. It is also important for the pathogenicity of other fungi, such as Cryphonectria parasitica, Puccinia recondita [21,22]. The Oh-GAP may function in the activation of the G-protein RACB. It is reported that G-protein RACB is required for full susceptibility of the leaf epidermis to the invasion by the biotrophic fungus B. graminis f. sp hordei. RACB is a common element of ingrowth of haustoria in leaf epidermal cells and the GTPase-activating protein is important for the process [23]. The fungal growth-related Oh-PC2 encodes phosphoenolpyruvate carboxykinase (PEPCK), which is an important enzyme required for gluconeogenesis [24]. Our data seemed to demonstrate that only the Oh-PC2 gene expression was significantly up-regulated at 3 dpi and 30 dpi, indicating its importance in the metabolism of O. heveae during infection of rubber tree.

The Oh-AAA-peroxin is homologous with a gene in the wheat powdery mildew genome. The Oh-RNP is homologous with the retrotransposon nucleocapsid protein of Metarhizium anisopliae (Table 1). It was reported that this gene is associated with pathogenhost interaction [25,26]. The Oh-Imp is homologous with the integral membrane protein of B. graminis, that is important for spore germination [19]. Our results indicated that the expression of these three genes were all up-regulated at 3 dpi, underlining their importance for O. heveae growth during the peak of the initial infection.

In the interaction of rubber tree with O. heveae, cell histology research indicates that hyphae grow 1 day after inoculation, mycelium starts to grow after 3 days, spores are produced after 30 days. Our data have demonstrated the different expression levels of different genes including those encoding hypothetic proteins at the initial and later stages of O. heveae infection on rubber tree.

While gene expression analysis is a useful tool to identify genes associated with a particular process, it is by no means definitive. Each gene needs to be validated for its function by knockout mutation analysis. In recent years, attention has been focused on pathogen effectors, many of which are secretory proteins or secondary metabolites. These effectors serve as virulence determinants or help shielding the pathogen from being detected by its host. In some cases, the plant host may recognize these effectors and activate its defense mechanisms. Our study has filled some gaps in the molecular study of O. heveae and its pathogenicity, providing the groundwork for future studies on this important powdery mildew fungus.

Acknowledgements

This work was supported by grants from the National Key Basic Research Plan of China (2011CB111612), National Natural Science Foundation of China (31160359), National agricultural industrial technology system (CARS-34-GW8), Doctoral Fund of Ministry of Education (20104601110004), research and start-up capital of Hainan University (kyqd1006).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 12227
  • [From(publication date):
    specialissue-2015 - Apr 27, 2018]
  • Breakdown by view type
  • HTML page views : 8414
  • PDF downloads : 3813
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]icsonline.com

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version