alexa Co-Habitation and Concurrent Infection of Dengue and Chikungunya Viruses in Aedes Aegypti Field Populations from India | Open Access Journals
ISSN: 2329-891X
Journal of Tropical Diseases & Public Health
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Co-Habitation and Concurrent Infection of Dengue and Chikungunya Viruses in Aedes Aegypti Field Populations from India

Raja Singh Kushwah, Jaspreet Jain, Anil Sharma, Raj K Bhatnagar, Sarala K Subbarao* and Sujatha Sunil*

International Centre for Genetic Engineering and Biotechnology, New Delhi, India

*Corresponding Author:
Sarala K Subbarao
Research Scientist, International Centre for Genetic Engineering and Biotechnology
New Delhi, India
Tel/ Fax: (011) 23235648
E-mail: [email protected]
Sujatha Sunil
Research Scientist, International Centre for Genetic Engineering and Biotechnology
New Delhi, India
Tel: 91-11-26741358 Extn: 162
E-mail: [email protected]

Received Date: December 16, 2015 Accepted Date: December 23, 2015 Published Date: December 30, 2015

Citation: Kushwah RS, Jain J, Sharma A, Bhatnagar RK, Subbarao SK, et al. (2015) Co-Habitation and Concurrent Infection of Dengue and Chikungunya Viruses in Aedes Aegypti Field Populations from India. J Trop Dis 4:194. doi:10.4172/2329-891X.1000194

Copyright: © 2015 Kushwah RS, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Tropical Diseases & Public Health

Abstract

Dengue and chikungunya have been identified as important re-emerging diseases in India. It has recently become a major health problem around the world, particularly in tropical and subtropical countries including India. Chikungunya fever is another re-emerging vector borne disease which is now being reported from areas previously unaffected with possibly changing epidemiology and severity of the disease. Aedes aegypti is the principal vector for the transmission of both of these arboviral infections. Information on vector population in the field vis-à-vis co-habitation of dengue and chikungunya viruses is of great importance in order to understand the role of vectors in the transmission of co-infections, but such information is presently lacking in India. We carried out a pilot survey in the states of Delhi and Haryana to estimate the presence of co-infections in Ae. aegypti during pre-monsoon, monsoon and post-monsoon seasons. This study is the first to report co-habitation of DENV and CHIKV in Ae.aegypti field population

Keywords

Aedes aegypti; Dengue, Chikungunya; Co-infection; Concurrent infectionsg

Short Communication

Aedes aegypti is an important vector mainly found in tropical and sub-tropical areas across the world [1] and is implicated in the spread of several arboviruses; most important of them being dengue virus (DENV) and chikungunya virus (CHIKV). Dengue caused by DENV and chikungunya caused by CHIKV are among the most important vector borne diseases affecting millions of people in India, with dengue contributing 34% (33 million infections) of the total global infections [2-4] and chikungunya contributing to spread of the infection to several other countries and serving as a transmission hub [5].

Dengue is an acute systemic viral disease that has established itself globally in both endemic and epidemic transmission cycles [6]. Dengue includes its two fatal syndromes, the dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) [7]. With more than onethird of the world population living in areas at risk of this infection, dengue virus is a leading cause of illness and death in the tropics and subtropics (scientific working group report on dengue, WHO 2006 [8]. Global distribution map of dengue has estimated and predicted India to be the worst affected [9]. Chikungunya, on the other hand, is a self-limiting disease causing morbidity in the affected individuals and occurs in two phases- an acute febrile phase and an arthralgic chronic phase. In India, chikungunya re-emerged in 2006 [10] after a gap of 32 years and since then has been occurring either as single infection outbreaks or as co-infections with dengue in different parts of India [11-15]. In the recent decades, all four serotypes have been circulating together in Delhi making it into a hyper-endemic state [16] and presenting with concurrent infections. Several clinical reports provide information on these co-infections [15,17]. Chikungunya tends to cluster geographically and overlap with dengue because both share some common symptoms [17].

Material and Methods

Aedes immatures (larvae and pupae) were collected during three different seasons in Delhi, ie, pre monsoon, monsoon and post monsoon. Collections were made once a month from May 2012- October 2012 from four study sites; two from the urban localities of Delhi (South Delhi and West Delhi) and rest two from semi urban localities of Haryana (Bahadurgarh and Bhadana), India. Each study site were around 20-25 kms apart from each other with South Delhi and Bhadana being the farthest localities. Details of the study sites used for the survey are shown in Table 1. Study sites were identified mainly on the basis of incidence of dengue and chikungunya cases reported in the previous years (MCD, NVBDCP), water storage conditions and socioeconomic factors of the population in those localities.

Study site Locality type Longitude Latitude
Delhi - South Delhi, West Delhi (2 districts) Urban 28°36'N 77°12'E
Haryana -Jhajjar, Bahadurgarh (2 districts) Semi urban 27°39'N 77°36' E

Table 1: Details of study sites.

After collections, the immatures were reared in the lab and upon emergence, adults identified [18-21]. After species identification, Aedes aegypti mosquitoes were separated on the basis of their sex and collection sites. Mosquitoes were pooled (n≤10 each for male and female) breeding site-wise and stored in Trizol at -80°C until further use. Using primers listed in Table 2, RT PCR for DENV serotypes and CHIKV were performed. The amplified products were purified, sequenced and phylogenetic analysis performed.

Origin Gene Sequence (5’ -> 3’) Amplicon size Source
CHIKV
E1 gene
Forward TACCCATTTATGTGGGGC 298 bps [14]
Reverse GCCTTTGTACACCACGATT
CHIKV
E1 gene
Forward GCTCCGCGTCCTTTACC 555 bps [54]
Reverse ATGGCGACGCCCCCAAAGTC
DENV Universal Forward TGGCTGGTGCACAGACAATGGTT 510bps [55]
  Reverse GCTGTGTCACCCAGAATGGCCAT  
DENV1 Forward GGGGCTTCAACATCCCAAGAG 405 bps
Reverse GCTTAGTTTCAAAGCTTTTTCAC
DENV2 Forward ATCCAGATGTCATCAGGAAAC 346 bps
Reverse CCGGCTCTACTCCTATGATG
DENV3 Forward CAATGTGCTTGAATACCTTTGT 196 bps
Reverse GGACAGGCTCCTCCTTCTTG
DENV4 Forward GGACAACAGTGGTGAAAGTCA 143 bps
Reverse GGTTACACTGTTGGTATTCTCA

Table 2: List of primers used in this study.

Results and Discussion

A total of 7007 immatures were collected during the six months. Details of the collection are described elsewhere. Testing for co-habitation in pools of mosquitoes in the urban sites revealed presence of DENV and CHIKV viral RNA (VNA) in ten pools out of the 38 pools tested. In case of per-urban sites, DENV and CHIKV positivity was seen in three of the 24 pools tested. Detail of pool positivity is provided in Table 3. These results clearly confirmed co-habitation of dengue and chikungunya viruses in the field mosquitoes (Figure 1). Sequencing of the amplified products and BLAST analysis of the sequence revealed DENV 2 serotype in all the samples. Phylogenetic analysis of CHIKV samples showed that the strains belonged to ECSA genotype.

Virus positivity/pool
  Urban Peri-Urban
Months No. of pools tested # No: of pools positive No. of pools tested # No: of pools positive
  CHIKV DENV CHIKV DENV
May 6 0 ND 3 0 ND
June 5 1 1 5 1 0
July 12 10 3* 4 4 1
August 5 5 ND 4 4 ND
Sept 5 5 1 4 4 1
October 5 5* 5* 4 4 1

Table 3: Details of pools positive for CHIKV and DENV through RT PCR.

tropical-diseases-community-Transcriptase

Figure 1: RT-PCR of DENV– CHIKV co-infection in Aedes aegypti pooled samples: Random mosquito pools belonging to each of the four study zones were taken and subjected to Reverse Transcriptase PCR for the amplification of (a) partial E1 gene (555bps) of CHIKV and (b) partial E gene (346bps) of DENV.

Studying reports of DENV occurrence in Delhi in the recent years revealed that there has been a serotype switch between 2011 and 2013. As our collection was done in the year 2012, we sought to test if there was concurrent infection of different DENV serotypes in the field mosquitoes. For this purpose, we selected samples from two time points, one prior to dengue cases occurrence in 2012, and the second one in the later part of the year. Serotyping of the mosquito samples yielded interesting results. Concurrent infection in the pooled mosquitoes was evident by specific bands through RT PCR for DENV 1, 2, 3. Furthermore, it was seen that samples collected in the month of July showed strong positivity for DENV 1 as evidenced by a thick band while DENV 2 and 3 showed poor amplification. In those samples collected in the month of October, however, DENV 2 showed a much distinct band while DENV 1 showed poor amplification (Figure 2). The amplicons were cloned, sequenced and BLAST analysis performed. Phylogenetic analysis was performed to confirm the genotypes and serotypes (Figure 3a-3c). In order to understand the pattern of DENV serotypes in the mosquitoes, we inspected the clinical cases that were prevalent in Delhi between 2011- 2012. Observed that DENV-1 was the circulating serotype in Delhi during 2010-2011. However, in 2012, reports on DENV prevalence in Delhi showed that DENV-2 along with DENV-3 replaced DENV-1. Post 2012, there has been a major shift in the incidence of DENV-2 (86%) in Delhi as reported. In our study, we performed the PCR for all the serotypes over the months. In the month of July, the samples were strongly positive for DENV 1 while DENV 2 and DENV 3 showed very poor amplification. However, in the samples collected in the later months of the year, DENV 2 showed a distinct amplification pattern and DENV 1 showed poor amplification. The results clearly corroborates with circulating DENV serotypes in the years. The samples in July were positive for DENV 1 from the previous year. However, due to factors presently unknown, DENV 2 and DENV 3 dominate over DENV 1 in the later months of the study. Those factors that facilitate this switch need to be studied in detail in order to understand this phenomenon. Our study has clearly established the presence of both DENV and CHIKV in the mosquito population. One previous study reported the presence of both CHIKV and DENV from Ae. albopictus collected from a co-infection patient’s residence.

tropical-diseases-community-genotyping

Figure 2: RT-PCR for genotyping of DENV serotypes and CHIKV co-infection in Aedes aegypti: Mosquito pools positive for DENV E gene 346bps further genotyped for serotypes along with CHIKV.

tropical-diseases-community-Chikungunya

Figure 3: Phylogenetic analysis of Chikungunya and Dengue field collected samples (a) Phylogenetic analysis of the sequenced CHIKV samples isolated from field collected mosquitoes from four study sites viz. Urban sites: South Delhi and West Delhi, Peri-urban sites: Bahadurgarh and Jhajjar (b) Phylogenetic analysis of the sequenced DENV2 samples isolated from field collected mosquitoes from three of four study sites viz. Urban sites: South Delhi and West Delhi, Peri-urban sites: Bahadurgarh and Jhajjar and (c) Phylogenetic analysis of the sequenced DENV1 samples isolated from field collected mosquitoes from one of four study sites viz. South Delhi.

This is the first report of concurrent infection of DENV serotypes along with co-infection with CHIKV from same pool of Ae. aegypti collected from field sites. Ideally, detecting both viruses from a single mosquito establishes co-infections within the mosquito that was beyond the scope of the methodology of this study as samples were pooled at the time of sample collection itself. But importantly it is to be noted that several of the pools that were positive were acquired from the same breeding sites. Since our collections were of only immature stages, it is reasonable to assume that these pools could have been generated from a single mother, thereby providing support to our hypothesis that both CHIKV and DENV can co-habit in Ae. aegypti.

The most interesting aspect of these experiments was the presence of several serotypes within the same pool of samples and the gradual switching over of serotypes within the mosquito. In-depth studies over a larger population of mosquitoes both in control conditions as well as from field population can reveal the dynamics of these viruses within the vector and the transmission potential of the vector of these viruses which could be achieved by studying the disease incidence from these localities during disease outbreaks. There is no doubt however; this pilot study has paved way for several interesting questions as to the role of vector in chikungunya and dengue transmission.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8053
  • [From(publication date):
    April-2016 - Sep 23, 2017]
  • Breakdown by view type
  • HTML page views : 7945
  • PDF downloads :108
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords