alexa
Reach Us +44-1764-910199
Determination of Genetic Similarities in Natural Populations of <em>Drosophila melanogaster</em> in Savanna Zone of Nigeria Using Microsatellite Markers
ISSN: 2168-9547
Molecular Biology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on Medical, Pharma, Engineering, Science, Technology and Business

Determination of Genetic Similarities in Natural Populations of Drosophila melanogaster in Savanna Zone of Nigeria Using Microsatellite Markers

Abdulazeez R1*, Auta J1, Shehu DM1, Ndams IS1and Umar AU2

1Department of Biological Sciences, Ahmadu Bello University, Zaria, Nigeria

2National Animal Production Research Institute, Ahmadu Bello University, Shika, Zaria, Nigeria

*Corresponding Author:
Abdulazeez R
Department of Biological Sciences
Ahmadu Bello University, Zaria, Nigeria
Tel: +234(0)7033701917
E-mail: [email protected]

Received date: October 07, 2016; Accepted date: October 17, 2016; Published date: October 24, 2016

Citation: Abdulazeez R, Auta J, Shehu DM, Ndams IS, Umar AU (2016) Determination of Genetic Similarities in Natural Populations of Drosophila melanogaster in Savanna Zone of Nigeria Using Microsatellite Markers. Mol Biol 5:177. doi:10.4172/2168-9547.1000177

Copyright: © 2016 Abdulazeez R, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Molecular Biology: Open Access

Abstract

This study was carried out to determine genetic similarities in natural population of Drosophila melanogaster in savannah zone of Nigeria using microsatellite markers. A total of 184 D. melanogaster was collected using simple traps baited with banana and baker’s yeast from Northern Guinea (Kaduna), Sudan (Kano) and Sahel (Azare). A total of 40 D. melanogaster were genotyped using 7 sets of microsatellite markers, the bands in the electrophoregramme were analysed and scored using the image Lab™. The result was used to compute dendrogramme based on Nei’s genetic distance using MEGA 6. Result showed that studied population forms two (2) clusters at various degrees of similarities with Sudan savanna and Sahel Savanna forming a cluster at 0.21 then grouped with Northern Guinea Savanna to form the second (2nd) cluster at 0.78 distances, suggesting that Northern Guinea Savanna and Sudan Savanna Drosophila melanogaster populations have a recent common ancestor.

Keywords

Genetic similarities; Drosophila melanogaster; Microsatellite; Savannah zone; Nigeria

Introduction

Drosophila melanogaster[1] is generally known as fruit fly or vinegar fly. The fly is said to have probably originated from sub-Sahara Africa [2], but is also able to proliferate under temperate climate which could be as a result of the spread of beneficial mutations in non-Africa populations [3-6] and recent selection pressure imposed by man such as resistance to insecticides [7]. D. melanogaster serves as a multiple model organism as its embryo, larva, pupa and adult can be used as models in different toxicological settings. For instance, the embryo and the pupa can be used as models in developmental toxicological studies; the larva can be used to study physiological and behavioural processes, while the adult fly possess structures that can mimic the equivalent functions of mammalian reproductive tract, heart, kidney, gut and lung. [8-13].

Microsatellites were described by [5] as a series of very short (2-10 bp), middle repetitive, tandemly arranged, highly variable DNA sequences dispersed throughout living organisms genomes. Microsatellite marker gives a much higher estimate resolution even at small spatial scales when compared with other markers [12]. The objective of the study is to determine genetic similarities among D. melanogaster populations in savannah zone of Nigeria.

Materials and Methods

The fruit flies were collected from six different locations throughout the savannah zone. Males were directly identified to species before preserving in separate vials from the females containing 70% ethanol and stored at -20°C. Genomic DNA used as a template for PCR reaction was isolated from all samples using phenol-chloroform method as described by a conventional hot start PCR was done using seven sets of primers developed from Flybase and PRIMER 3 software. A 10 μL PCR reaction was performed using 100 ng of genomic DNA, 1.5 mM MgCl2, 200 μM dNTPs, 1 μM of each primer, 0.5 units Taq DNA polymerase. An initial denaturation at 96°C (5 min), annealing at 53oC (1 min) and extension at 72°C (5 min) for 30 cycles.

PCR product was run on 1.5% agarose gel stained with ethidium bromide and visualized by Molecular Imager®Gel DocTM XR+system with image LabTM software of BIO-RAD calibrated to high sensitive level (75%). The bands in the electrophoregramme were analysed and scored using image LabTM and dendrogramme was established using MEGA 6 (Table 1).

LOCUS PRIMERS BASE SIZE(bp) ANNEALING TEMP.(°C) GC %
DM18   205 59.47,59.96 45.00
F GCCGGCCAAACTTAACAATA      
R GCCGGCCAAACTTAACAATA      
DMPROSPER   201 60.01,60.05   50.00
F AGGCAAACAAAGGTGTGTCC      
R GGGAGGTCACTCATCTTGGA      
Antp1   199 59.99,59.93   55.00
F CAAGGACTTGCGTTCTCTCC      
R CACCTACGCGTTCGACTACA      
DROACS2   201 59.83,59.80 50.00
F TGTTTGGATGAGTCCAGCAG        
R ATCTCCACCTGGTACGGATG      
DM30   203 59.94,59.93 45.00
F TTTGGGTTTCTATCGCCAAC      
R AGGGAACTGTCCATGAATGC      
DMWHITE   207 59.59,59.98 45.00
F GGTAAGCAGGGGAAAGTGTG      
R ATTTTTGTGGGTCGCAGTTC      
DMtena   200 59.97 40.00
F ACAATTTGCGTTGGGAAAAG      
R ACGGACAGGACCTCAATCAC      

Table 1: Drosophila melanogaster primers for genetic diversity assessment.

molecular-biology-Drosophila-melanogaster

Figure 1: Dendrogramme representing phylogentic relationship of Drosophila melanogaster in Savanna zone of Nigeria.
(Kaduna=Northern Guinea Savanna, Kano=Sudan Savanna, Azare=Sahel Savanna).

Results and Discussion

The dendrogramme (Figure 1) based on the 7 Microsatellite markers used on the basis of Nei’s genetic distance indicated that studied population forms two (2) clusters at various degree of similarities with Sudan savanna and Sahel Savanna forming a cluster at 0.21, indicating a low level of genetic similarity. The first cluster then grouped with Northern Guinea Savanna to form the second (2nd) cluster at 0.78 distance showing a high genetic similarity among populations studied. The resulting clusters further support population subdivision in D. melanogaster. This is collaborated by several other studies [4,11,12].

Conclusively, consistent cluster formed between the populations which quantified the degree of relationships between D. melanogaster in the various vegetation zones with Northern Guinea Savanna closely related to Sudan Savanna.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 8616
  • [From(publication date):
    October-2016 - Apr 25, 2019]
  • Breakdown by view type
  • HTML page views : 8524
  • PDF downloads : 92
Top