alexa Developing Strategies for Early Detection of Hepatitis B Infection | OMICS International
ISSN: 2327-5073
Clinical Microbiology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Developing Strategies for Early Detection of Hepatitis B Infection

Saurabh Bandhavkar*

Department of Biochemistry, G. S. Medical College and KEM Hospital, Mumbai, Maharashtra, India

*Corresponding Author:
Saurabh Bandhavkar
Department of Biochemistry
G. S. Medical College and KEM Hospital
Mumbai, Maharashtra, India
Tel: +91-8879879008
E-mail: [email protected]

Received Date: January 20, 2016 Accepted Date: February 12, 2016 Published Date: February 19, 2016

Citation: Bandhavkar S (2016) Developing Strategies for Early Detection of Hepatitis B Infection. Clin Microbiol 5:234. doi: 10.4172/2327-5073.1000234

Copyright: © 2016 Bandhavkar S. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Clinical Microbiology: Open Access

Hepatitis B caused by hepatitis B virus (HBV) is regarded as the most common form of chronic hepatitis worldwide. Around 15%-40% of people infected with HBV develop HBV-related complications and approximately 25% die as a result of these complications. Since HBV is infectious and spreads through blood, semen and other body fluids, it will be easy to detect the presence of this virus in these body fluids. Polymerase chain reactions (PCR) assays are often employed to detect these viruses in blood. While most of these assays generally rely on detection of HBV Surface Antigen (HBsAg) or hepatitis b core IgM Antibody (anti-HBc IgM), recent developments have made possible the detection of HBV DNA in blood. These assays, however, necessitate the requirement of adequate controls to distinguish true from false negative results. To address this issue, we have developed positive controls for Hepatitis B virus using molecular biology techniques. These controls can be used in PCR assays for detection of HBV by competitive amplification, thereby allowing detection of false negatives. The controls developed in this study were successfully tested with virus-seeded blood sample concentrates.

HBV; pBS; Controls

Hepatitis B is a devastating infectious disease affecting the liver that is caused by the hepatitis B virus (HBV). It is capable of causing both acute and chronic infections. No symptoms can be detected in many cases during the initial infection. These symptoms spontaneously develop which can be seen as vomiting, yellow fever, abdominal pain and dark urine. Mode of transmission is generally through blood and other body fluids [1]. Contact with infected fluids during childhood or infection during birth is the most common cause that results in chronic hepatitis B. Intravenous drug use and sexual intercourse may also lead to transmission of the virus. About a third of the population is infected by hepatitis B virus at some point in their life [2]. Over 8,00,000 patients die due to hepatitis B each year, majorly due to liver diseases [3]. Therefore, early detection and routine surveillance of virus are the routes to management, control and eradication of this disease. Many molecular-biology techniques are available for detection of virus, PCR being the most widely adopted. However, one problem associated with any molecular detection assay is the potential for false negative results. A false negative result may appear due to many cases such as PCR inhibitors, poor DNA extraction, and target DNA degradation before amplification or even manual errors in setting up a reaction [4-15]. Therefore, the presence of positive control will ensure the efficient run of the PCR as well as help in monitoring the PCR procedure [16,17]. Ultimately the positive control can be monitored by resolving the reaction products on an agarose gel [12]. In this study, we have developed positive controls by amplifying the surface antigen gene present in the HBV genome. The positive control used is a 208 bp long DNA. Compared to nested PCR as the reference standard, the real-time assay has a sensitivity of 99.5%, specificity of 100%, positive predictive value of 100%, and negative predictive value of 99.6% for the detection of viruses. Our assay uses species-specific forward primers in combination with a conserved reverse primer and largely overcomes primer competition for the minor species DNA. With a blind panel of clinical samples, we successfully identified the species in 12/16 mixed infections. This assay was further validated with 97 blood samples and demonstrated a specificity and sensitivity for single infections of 100% compared with nested PCR as the “gold standard.

Materials and Methods

HBV viruses and viral DNA extraction

Blood infused with HBV virus was collected in an EDTA vacutainer. The tube was centrifuged at 25000 rpm to separate RBCs and the separated plasma was transferred in a separate eppendorf and stored at -80°C. Viral DNA was extracted by taking 200 μl of the plasma with the help of Invitrogen’s viral DNA kit by Life Technologies using the manufacturer’s instructions. The viral DNA was eluted in 40 μl of elution buffer. For long term use, extracted DNA was preserved at -80°C whereas for short term use, it was preserved at -20°C.

Preparation of positive controls of viral DNA

The positive control DNA template was constructed using two oligonucleotide primers which were custom made. Each primer consisted of a positive strand and a complementary negative strand, so that it can be easily annealed in a DNA fragment [5]. The first pair consisted of Forward (+), AAAATTCGCAGTCCCCAAC and the forward (-), TTTTAAGCGCAGGGGTTG. The second pair consisted of Reverse (+) and the reverse (-), with sequences GTCCCGTGCTGGTAGTTGAT and CAGGGCACGACACCATCAACTA respectively (Figure 1). The primers were designed to have binding sites for HBV S-gene forward(S-gene+151 AAAATTCGCAGTCCCCAAC) and the S-gene reverse (S-gene -323 ATCAACTACCAGCACGGGAC) in the S-gene forward (+) and the S-gene reverse (-) respectively. The complementary primers were denatured at 95°C and reannealed at 58°C. The primers were fashioned in such a manner that they could be used in a blunt end ligation using a single restriction site.

Figure 1: Nucleotide sequence of S-gene. The former boldface represents the forward primer (+) and latter represents the reverse primer (-).

Preperation of S-gene amplicon

An amplicon of HBV S-gene with a size of 208 bp was generated from the viral DNA using the above primers by setting up a RT-PCR with the help of Qiagen’s one step PCR kit. The Qiagen’s one step PCR kit was used with a 30 μl reaction mixture along with 1.2 μl of enzyme mixture supplied by the kit (along with hot start Pfu. Pol), Pfu buffer, 10 pmol of each (S-gene forward and S-gene Reverse) primers (0.5 μl), 400 Um (each) of deoxynucleoside triphosphate and 5 mM MgCl2. The thermo cycling conditions for PCR included heat start activation of Pfu Polymerase at 94°C for 5 mins followed by 40 cycles of PCR amplification with each cycle consisting of 30 s of denaturation at 94°C, 30 s of annealing at 60°C, 45 cycles of elongation at 72°C and one final cycle of elongation at 72°C for 10 mins [6]. The PCR was carried out using GeneAmp PCR system 2700 from applied bio-systems. The probes used for monitoring the RT-PCR were Vic and Fam. The amplicon was loaded in a 0.75% agarose gel and checked for its purity and size (208 bp) along with a 100 bp thermo fisher DNA ladder. The gel was cut at the appropriate band size and the amplicon was gel eluted in 35 μl of TE buffer provided in the Qiagen’s gel extraction kit and was stored at -20°C for short term use and -80°C for long term use.

Manipulation of viral DNA and vector DNA

Restriction digestion of the vector DNA and agarose gel electrophoresis of DNA were carried out using standard protocols. The vector used was pBlueScript (pBS) KS II+ and the restriction site targeted in the Multiple cloning site of the pBS vector was Eco RV (GAT^ATC). The enzyme was found to cut the site in 15 mins and the reaction was set up accordingly [7,8]. The ligation and cloning of DNA was carried out using T4 DNA ligase from Promega (Madison, WI) according to manufacturer’s instructions. Being a blunt end ligation, higher quantities of ligase and insert (amplicon) were added to the reaction mixture, along with Polyethylene glycol (PEG) so as to aid the blunt end ligation. Ligation was set up at lower temperatures than usual (22°C) so as to avoid heat inactivation of PEG [9].

Transformation and screening for positive colonies

The ligation mixture was added to 100 μl of competent Top 10 E. coli cells and transformation was carried out using standard protocols. 10 μl of transformation was then loaded on luria agar plate containing 1mg/ml of Ampicillin, 100 mM/ml of Isopropyl beta-Dthiogalactopyranoside (IPTG) and 40 μg/ml of X-gal (5-bromo-4- chloro-3-indolyl-beta-D-galactopyranoside). The plates were incubated overnight at 37°C and based on blue-white screening principle [10] (Figure 2), white colonies were picked and screened for presence of HBV amplicon by setting up a screening PCR. The positive clones obtained were reconfirmed using two pairs of vector specific primers, which were so designed that they amplify the entire cloned region of S-gene of HBV along with some portion of the pBS vector. The first pair consisted of T17 forward (+), TAATACGACTCACTATAGGG and T17 forward (-) ATTATGCTGAGTGTGATATCCC. The second pair consisted of M13 reverse (+), GGAAACAGCTATGACCATGA and M13 reverse (-), CCTTTGTCGATACTGGTACT. The primers were designed to have binding sites for sequence TAATACGACTCACTATAGGG and reverse sequence TCATGGTCATAGCTGTTTCC in the T17 forward (+) and M13 reverse (-) primers, respectively, described above. The amplicon obtained using these primers in a wild type pBS vecor was 201 bp, whereas in a recombinant pBS vector containing the cloned HBV region, the amplicon generated using these primers was found to be 409 bp long (Figure 3). This indicated the successful insertion of portion of S-gene of HBV in the pBS vector.

Figure 2: Cloning of Portions of S-gene into pBlueScript KS II +vector and transformation into top 10 E. coli competent cells.

Figure 3: Screening PCR using white colonies and vector specific primers (M13 rev. and t17 fwd.). Lane 1: 100 bp ladder; Lane 2, 3: Recombinant pBS; Lane 4: Wild type pBS; Lane 5: Negative control; Lane 6: Distilled water.

Thus, the PCR product(amplicon) obtained after amplification by the custom designed primers was cloned in the multiple cloning site (MCS) of pBlueScript (pBS) KS II+vector using Eco RV restriction site to generate the recombinant plasmid containing the S-gene of HBV. The nucleotide sequence derived from the cloned template in pBS matched to the sequences of the oligonucleotide primers used to construct the positive control template and was found to be 208 bp long, as expected. The purity of the template DNA was tested on agarose gel electrophoresis. The purified DNA template was then stored in RNAse free Tris-EDTA buffer (pH 8.0) at -80°C. The template DNA used was serially diluted and used in the assay so as to determine the Minimum detection level (MDL).

The construction of positive control for Hepatitis B virus was described in materials and methods. The MDL of the positive control was determined to be 0.12 pg for RT-PCR. The stability of the controls was tested under changes in storage conditions. The positive controls were stable for at least six months when stored in Tris-EDTA buffer at -80°C. In the same period, the control was slightly destabilized when stored at -20°C and slightly more destabilized when stored at 4°C-10°C.

Inhibition studies: One of the major problems associated with PCR diagnosis is the presence of PCR inhibitors [6]. The presence of PCR inhibitors was evaluated in blood, serum and plasma. The results showed no inhibition of amplification of viral DNA extract.

An extremely important step towards the management control and eradication of Hepatitis B virus in course of Hepatitis B disease is its early detection. PCR is widely used molecular assay for detection of the infection at an early stage [11]. Although PCR is sensitive and specific for is target, there are still concerns with false negative results. In this research, we therefore developed positive controls which can help identify and detect false negative result and thus increase the specificity and sensitivity of the PCR assays [13]. A major advantage associated with the use of these positive controls is that they detect the HBV DNA. The HBV DNA is a reliable marker for detection of hepatitis B Virus [14] which can help in (1) distinguishing active infection from inactive (2) help in monitoring the patient’s response to anti-HBV therapy (3) Further, HBV DNA can be detected in blood almost 21 days prior to the appearance of HBsAg in blood, thus facilitating early detection [15]. Thus, developing positive controls is a very economical and time saving method for easy detection of hepatitis B virus.

I would sincerely like to thank the entire team of BioGenomics Ltd for their support and provision of all the required materials.

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8485
  • [From(publication date):
    February-2016 - Mar 18, 2018]
  • Breakdown by view type
  • HTML page views : 8372
  • PDF downloads : 113

Review summary

  1. Heid CA
    Posted on Jul 13 2016 at 7:31 pm
    The manuscript depicts the innovation of a HBV control DNA sample which can be used to detect HBV infection in blood samples using PCR technology. The controls prepared by the authors tend to differentiate the false negative results from the true ones. However the article does not specify the exact PCR conditions for simultaneous amplification of the pathogenic HBV infected blood sample and the control. The clinical efficacy of the assay, including for the positive control, the sensitivity, specificity, predictive values for positive and negative results need to be studied.

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version