alexa Development of Simple and Rapid Diagnostic Method for Strawberry Latent Ring-spot Virus in Plants Using Loop-Mediated Isothermal Amplification Assay | Open Access Journals
ISSN: 2157-7471
Journal of Plant Pathology & Microbiology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Development of Simple and Rapid Diagnostic Method for Strawberry Latent Ring-spot Virus in Plants Using Loop-Mediated Isothermal Amplification Assay

Jin-Ho Kim1, Siwon Lee2, Ji-Young Choi1, Sue Kyung Kim1 and Won-Cheoul Jang1,3*

1Department of Chemistry, College of Natural Sciences, Dankook University, Cheonan 31116, Korea

2Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon 22689, Korea

3Institute of Tissue Regeneration Engineering (ITREN), Dankook University, Cheonan 31116, Korea

*Corresponding Author:
Won-Cheoul Jang
Department of Chemistry
College of Natural Sciences
Dankook University, Cheonan 31116, Korea
Tel: +82415296071
Fax: +82415597860
E-mail: [email protected]

Received date: September 08, 2016; Accepted date: September 29, 2016; Published date: September 30, 2016

Citation: Kim J, Lee S, Choi J, Kim SK, Jang W (2016) Development of Simple and Rapid Diagnostic Method for Strawberry Latent Ring-spot Virus in Plants Using Loop-Mediated Isothermal Amplification Assay. J Plant Pathol Microbiol 7: 377. doi: 10.4172/2157-7471.1000377

Copyright: © 2016 Chaturvedi H, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Plant Pathology & Microbiology

Abstract

Strawberry Latent Ring-spot Virus (SLRSV) is seed or nematodes-transmitted viruses, and causes quantitative and qualitative loss of various crops. SLRSV is a non-reported, potentially control able virus, which is managed at the national level. Currently, RT-PCR and nested PCR system are the standard methods of detecting SLRSV, but more effective methods are required. In this study, loop-mediated isothermal amplification (LAMP) assay was used for detection of SLRSV. As a result, the LAMP assay showed sensitivity similar to that of the currently used method, but is more rapid (approximately 8 hrs), simple and specific. In addition, results can be verified by restriction fragment length polymorphism (RFLP) using BfaI, or sequencing after the LAMP reaction. Therefore, we have shown that the LAMP assay developed in this study is a potential marker for the facilitation of rapid and simple screening of SLRSV in plants, which will ultimately be useful for the diagnosis of SLRSV infected plants and quarantine.

Keywords

BfaI; LAMP; SLRSV (Strawberry Latent Ring-spot Virus)

Introduction

Strawberry Latent Ring-spot Virus (SLRSV) was first discovered in Scotland and classified in the genus Nepovirus as a plant pathogen of the Group IV positive-sense ssRNA viruses [1,2]. SLRSV is classified into the family Secoviridae (International Committee on Taxonomy of Viruses; ICTV) and is transmitted by seeds and soilinhabiting nematodes (Xiphinema diversicaudatum and X. coxi) [3]. The infection by SLRSV forms tubule-like structures, facilitating the mechanism of cell-cell translocation through plasmodesmata [4,5]. Some of the typical symptoms after infection include chromatic and/ or morphological alteration of leaves. This virus has a wide host range, attacking many economically cultivated crops [6,7]. For example, SLRSV was recently found to infect olive in Syria, Oriental hybrid lily in Northern India, strawberry fields in United States, and black locust (Robinia pseudacacia L, family Fabaceae) in Poland [8-11]. The hosts of this virus in Korea are Rosa spp., Aesculus spp., Trifolium spp., Peteroselinum crispum, Vitis spp., Fritillaria imperialis, Humulus lulus, Euonymus europaeus, Pastinica sativa, Laminum amplexicaule, Ribes spp., Rubus spp., Delphinum spp., Fragaria ananassa, Muscari spp., Lilium spp., Paunus spp., Apium graveolens, Narcissus spp., Robinia peudoacacia, Asparagus densiflorus, Prunus avium, and Prunus [12]. Despite its wide geographical distribution, SLRSV has not been reported in Korea; however, the possibility of its emergence and significant economic damage has been raised [12].

In Korea, SLRSV has been detected using reverse transcriptionpolymerase chain reaction (RT-PCR) and nested PCR [13]. However, the reaction time for these PCR methods is time-consuming and laborious, requiring 10 hrs to obtain results, due to the post- PCR reaction and gradient of cycling temperature between three amplification steps. As a consequence, they are inconvenient for rapid diagnosis and point-of-care applications [14,15]. In recent year, nucleic acid-based amplification methods are demanded low-cost, rapid, specific and easy in comparison with traditional methods. Loop mediated isothermal amplification (LAMP) does not require a thermal cycler or analysis software and can be performed using an oven and/or water bath [14,16-21]. Moreover, LAMP is more specific and rapid than PCR-based methods because four specially designed primers (forward inner primer [F1c, F2], reverse inner primer [B1c, B2], outer primers [F3, B3]) bind to six specific regions on the target DNA [22]. These features of LAMP assay have been found to be efficient for detecting many pathogenic organisms including virus, bacteria, and fungi [23]. Therefore, LAMP will be useful both for the diagnosis of SLRSV infected plants and quarantine. In this study, we developed a LAMP assay for rapid detection SLRSV with high specificity as compared to RT-PCR and nested PCR.

Samples of SLRSV and reference viruses [Cucumber Mosaic Virus (CMV), Carnation Ringspot Dianthovirus (CRSV), Cherry Leaf Roll Nepovirus (CLRV), Grapevine Fanleaf Nepovirus (GFLV), Little Cherry Virus (LchV), Tomato Black Ring Nepovirus (TBRV), Tomato Ringspot Nepovirus (ToRSV), Tomato Spotted Wilt Tospovirus (TSWV), Tobacco Streak Ilarvirus (TSV), Raspberry Ringspot Nepovirus (RpRSV) and Prune Dwarf Ilarvirus (PDV)] were collected with approval for import of prohibited goods. For RNA extraction from these samples, we used an RNA-spin™ II P RNA extraction kit (iNtRon, Korea) and cDNA was synthesized using a ReverTra Ace-α-® (TOYOBO, Japan) [24,25]. RNA of 170-200 ng/ul was extracted from the samples, and used for synthesis of 100 ul cDNA. To design LAMP primers, the sequences of three SLRSV strains (NCBI accession numbers NC006965, X77466 and X75165) and 101 reference virus strains with high sequence similarity or the family Secoviridae were collected from the National Center for Biotechnology Information (NCBI). The sequences of the collected viruses underwent multiple alignments using the BioEdit version 7.0.0 software, and six sets of LAMP primers for detection of SLRSV were designed using the PrimerExplorer software (Table 1). SLRSV template cDNA was reacted for 1 hr at three different temperatures (60, 62, and 65°C) to determine the optimum LAMP conditions for detection of SLRSV after 10 min at 95°C and 1 min at 4°C. The LAMP reaction was conducted in 2 ul buffer (1 x; 20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100, pH 8.8), 1.5 ul of template DNAs (100 ng/ul), 2.0 ul of 10 mM dNTP mix (2.5 mM each), 0.6 ul of F3 (forward) and B3 (backward) primers (10 pmoles/ul), 1.4 ul of FIP (forward inner primer) and BIP (backward inner primer) (10 pmoles/ ul), 1.5 ul of Bacillus stearothermophilus (Bst.) DNA polymerase (8 U/ ul, New England Biolabs, USA).

Set Primer Sequence (5’→3’) Length (bp) G+C (%) Tm (°C)
SLRSV_1 F3 GGTTAGAACTGCTATTGTGG 20 45.0 50.7
B3 CCTCGAGATCCTCTTCAA 18 50.0 50.5
FIP CGTCAGAATCAAATCGGTACTTACCAACCTTCGATTACACT 41    
BIP TTAACATTGCAGGACGTTGATAAACCCATTCAGCCCAC 38    
SLRSV_2 F3 CAGTTGGTGTGGATTTCC 18 50.0 50.9
B3 AAAGCCAAATGCAAGCAG 18 44.4 51.8
FIP CTCTTAAGACGCTCTTGAGGACGTTCTGGAGCTAACAACAG 43    
BIP ACACATTTCAATAGCCTTCTGCCTCCATTTACCAACGGAA 40    
SLRSV_3 F3 CTGGTAGCTTGCTCACAA 18 50.0 52.2
B3 CCCGATTGCTGATGATGG 18 55.6 53.5
FIP AACCCGATGCCTGAATACGGGAGGCTAGTTTGCTGCTC 38    
BIP GCCAGGCCACAAGTAGTGAGCTCTTCTCTCCAACCAGC 38    
SLRSV_4 F3 ATTCGCATGCTCTCTTTG 18 44.4 50.4
B3 TCTCTGCAGCTTGGAAAT 18 44.4 51.4
FIP GAGAAGGTGGTAAGCAACTGTACGCCTGAATATTCACTACG 41    
BIP GATGCACACTTTCTCCCTGAAACCCTTTTAACCCCGAG 38    
SLRSV_5 F3 CTCTTAAGGATACAGAGTGG 20 45.0 49.1
B3 TGACAACTTTAAAGGCGC 18 44.4 50.8
FIP CTTAGCTTGAATGGGAGCTGAAAAGTTACACCTTCATGCG 40    
BIP CTTGGTTTATGCCTGGTAGACTCATTATGGAGTAGCCAGAC 41    
SLRSV_6 F3 GTGGTAGTGGTTCTCTGT 18 50.0 51.0
B3 GTAAGCGGAAAAGAGGTG 18 50.0 50.6
FIP CGACCCCTTCTTTGTGGTGTTGATTATGGGCAATCTCTGA 40    
BIP GGAGATTGAATCCGGCAACTAGTTCCAACTTGAACAACAGG 40    

Table 1: Loop-mediated isothermal amplification primer sequences to quickly detect Strawberry Latent Ring-spot Virus (SLRSV).

We confirmed the specificity of the LAMP assay using the designed primers for SLRSV. A specific reaction occurred at all temperatures and detected that the optimal reaction condition was at 62°C. Among a total of 6 primer sets, the amplified DNA product with a primer set 5 did not show nonspecific amplification and the negative control for all reference viruses (CMV, CRSV, CLRV, GFLV, LchV, TBRV, ToRSV, TSWV, TSV, RpRSV and PDV) (Figure 1). Thus, the subsequent LAMP reactions were conducted using the primer set 5. Instead of an expected single band size of cDNA fragment (446 bp) for SLRSV from nested PCR, the LAMP product of the positive sample visualized by gel electrophoresis displayed multiple bands of different sizes like a ladder of DNA fragments because of the formation of stem-loop DNAs of various stem lengths (Figure 2). As shown in Figure 1, the primer set 5 appeared as a typical ladder-like pattern which had high specificity to SLRSV. Both LAMP and nested PCR cDNA products were equivalent and able to detect up to 10-2 dilution (Figure 2) [13].

plant-pathology-microbiology-Amplification-SLRSV-viruses

Figure 1: Amplification of SLRSV and reference viruses using the designed LAMP primer sets. Lane M, 100 bp marker (Genepia, Korea); lanes 1 to 6, number of LAMP primer sets for detection of SLRSV. [Strawberry Latent Ringspot Virus, (SLRSV); Cucumber Ringspot Dianthovirus, (CMV); Tomato Black Ring Nepovirus, (TBRV); Tomato Spotted Wilt Tospovirus, (TSWV); Raspberry Ringspot Nepovirus, (RpRSV); Prune Dwarf Ilarvirus, (PDV); Tomato Ring-spot Nepovirus, (ToRSV); Tobacco Streak Ilarvirus, (TSV); Carnation Ring-spot Dianthovirus, (CRSV); Cherry Leaf Roll Nepovirus, (CLRV); Little Cherry Virus, (LchV); Grapevine Fanleaf Nepovirus, (GFLV)].

plant-pathology-microbiology-Sensitivity-LAMP-nested

Figure 2: Sensitivity of the LAMP and nested PCR assay for detecting SLRSV. Lane M, 100 bp marker (Genepia); lanes 100 to 10-9, amplification of ten-fold serial dilutions of total cDNA including SLRSV; lane N, negative control.

To confirm the specificity of the LAMP products, 10 ul of LAMP amplicons were digested with 10 U of the restriction enzymes BfaI (5’- C/TAG-3’) (New England Biolabs, USA) at 37°C for 2 hrs. Fragments of restriction fragment length polymorphism (RFLP) products were electrophoresed in 1.5% agarose gels and stained with ethidium bromide (EtBr) [digestion fragments (159 and 138 bp)]. In addition, the product of conventional PCR using outer primers (F3 and B3) was used to Sanger sequencing. PCR products ware purified using the AccuPrep® PCR purification kit (Bioneer, Korea), and sequencing was performed by Macrogen Co. (Korea). Sequencing data were analyzed by Sequencher software version 5.0 (Gene Codes Corporation, USA). Our results showed that the LAMP assay can detect SLRSV in imported samples within 1.5 hrs (30 mins for cDNA synthesis, 60 min for LAMP) after RNA extraction, and as described here, it is easier, simpler and more specific than PCR-based methods. Thus, this method reduces the detection time compared to the previous 10 hrs necessary for RTPCR, nested PCR, and electrophoresis steps. After LAMP assay, we performed RFLP using the restriction enzyme BfaI [digestion fragments (159 and 138 bp)], and direct sequencing. Our results confirmed that the LAMP products used in this study had correct digestion fragments and sequence of SLRSV (Figures 3A and 3B).

plant-pathology-microbiology-Restriction-fragment-length

Figure 3: Restriction fragment length polymorphism (RFLP) analysis of the LAMP assay amplicon with Bfa I enzyme. (A) Result of RFLP through 1.5% agarose gel. (B) Sequence information of Bfa I activation site in the amplicon.

The PCR based methods combined with RFLP has been used as effective tools for the identification and differentiation of plant viruses such as tobamoviruses [26]. Standard molecular biological detection method of SLRSV has involved RT-PCR and nested PCR since 2010 in Korea. However, no modified-plasmid positive control at quarantine sites can be used with these methods. A modified-plasmid positive control has since 2012 been applied to full-scale standard tests [13]. Accordingly, LAMP assay required to develop a positive control, as well as PCR –based methods. Previously, we reported that developed a LAMP assay for detection of Wheat Streak Mosaic Virus (WSMV) that enabled rapid detection during quarantine inspections [27]. In future, we plan to develop rapid, simple, and user-friendly LAMP assays for detection of non-reported, latent, harmful viruses, because the LAMP assay is a powerful diagnostic assay for screening various pathogens.

Conclusion

In conclusion, SLRSV is non-reported potential controlled virus that has problems about economic, yield and quality damage to various crops. Therefore, fast, easy handle, and commercial method is demanded in society, and consequently, we developed a LAMP assay to detect SLRSV in this study, which was more rapid and simple than RTPCR and nested PCR (Table 2). The LAMP assay showed sensitivity similar to the PCR-based methods; however, this method had high specificity because of four primers targeting six distinct regions on the target DNA when compared to PCR primers that recognize two regions. This specificity allows accurate diagnosis through verification of specific amplicons by RFLP and sequencing after the LAMP reaction Moreover, LAMP can be evidently reduced the processing time more than 6 to 8 hrs because it alleviates the time for gel electrophoresis (Table 2).

Steps Reaction time
Nested PCR LAMP
Extraction 2 h 2 h
cDNA synthesis 30 min 30 min
RT-PCR 3 h N/A
Amplification 3 h 1 h
RFLP N/A 2 h
Electrophoresis 2 h* 30 min
N/A: Not association; *Electrophoresis is repeated PCR reaction steps, respectively.

Table 2: Processing time of Nested PCR and Loop-mediated isothermal amplification (LAMP).

Acknowledgment

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (Grant number: 2009-0093829).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8393
  • [From(publication date):
    September-2016 - Nov 20, 2017]
  • Breakdown by view type
  • HTML page views : 8259
  • PDF downloads : 134
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords