alexa Effects of Folic Acid-Fortified Milk Consumption on Serum Folate Levels in Japanese Female Students: a Randomized Controlled Trial Stratified by Methylenetetrahydrofolate Reductase C677T Genetic Polymorphism

ISSN: 2376-1318

Vitamins & Minerals

Effects of Folic Acid-Fortified Milk Consumption on Serum Folate Levels in Japanese Female Students: a Randomized Controlled Trial Stratified by Methylenetetrahydrofolate Reductase C677T Genetic Polymorphism

Chiyogiku Mitsukuchi1, Yoshiko Kumagai2, Hiroko Yasutomo2, Yuuki Ito2, Motoji Kitagawa1, Kotoyo Fujiki1 and Yuko Tokudome1*
1Graduate School of Nutritional Sciences, Nagoya University of Arts and Sciences, Japan
2School of Nutritional Sciences, Nagoya University of Arts and Sciences, Japan
*Corresponding Author: Yuko Tokudome, Graduate School of Nutritional Sciences, Nagoya University of Arts and Sciences, Japan, Tel: +81-561-75-2192, Email: [email protected]

Received Date: Sep 08, 2017 / Accepted Date: Sep 18, 2017 / Published Date: Sep 25, 2017

Abstract

Objective: We studied effects of fermented milk fortified with 200 μg of folic acid (FF milk) on serum folate levels in Japanese women university students.

Methods: Adopting FF milk as intervention factor, a randomized controlled trial stratified by MTHFR genetic polymorphism C677T was conducted in 143 university women students. Experimental group subjects were requested to consume FF milk for 4 weeks; control group subjects to consume usual meals. Dietary surveys were conducted using an FFQ, and serum folate concentrations were analyzed utilizing chemiluminescence immunoassay. Using oral mucous membranes, MTHFR genotypes were determined employing PCR-RFLP. Paired ttest, one-way ANOVA, Pearson correlation coefficient, Chi-square test, or Fisher’s exact probability test was adequately applied.

Results: MTHFR genotype frequencies were CC type 36 (25%), CT type 75 (52.4%) and TT type 32 (22.4%) as a whole. The subjects were randomly stratified into 73 experimental group (CC type 16, CT type 41, TT type 16) and, 70 control group (CC type 20, CT type 34, TT type 16). Average of folate consumption was 246 μg/day. Average serum folate level was 9.8 ng/mL with statistically significant difference by MTHFR genotype (CC type>CT type>TT type).

Serum folate concentrations in the experimental group increased by 1.5 on average after intervention. At baseline, there were 19 subjects having serum folate levels lower than the reference value of NTDs (7 ng/mL): CC type 1/36, CT type 10/75 and TT type 8/32 with statistical difference by MTHFR genotype. In the experimental group those subjects decreased from 10 to 2 (CT type 1 and TT type 1) after intervention.

Conclusions: Serum folate levels increased in the experimental group subjects after intervention, suggesting consumption of the FF milk sufficiently elevated serum folate concentrations for prevention of NTDs, irrespectively of MTHFR genotypes.

Keywords: Folic acid; Milk; Fortification; Randomized controlled trial; Neural tube defects; Serum folate; Methylenetetrahydrofolate reductase C677T

Introduction

Human fetal neural tube closes approximately up to 4 weeks of gestation. During this period folate deficiency elevates the risk of neural tube defects (NTDs). Many epidemiologic studies reported that additional consumption of folic acid before and during the early gestation period decreased the onset of NTDs [1-5]. Following these observations, many countries recommended consumption of supplements containing 400 μg or over of folic acid or of folic acidfortified food four weeks or more 4 weeks before-12 weeks after gestation in addition to dietary folate from regular meals [6,7]. In 1999, a large intervention trial in China using a supplement containing 400 μg of folic acid demonstrated the reduced development of NTDs by 40% (at lower prevalent areas) by 80% (at higher prevalent areas) [8]. Since 2000, like western countries, the Ministry of Health, Labor and Welfare, Japan advised women potentially being pregnant, women planning pregnancy, and pregnant women to consume 400 μg/day of folic acid in addition to dietary folate from well-balanced daily meals [9]. Generally speaking, women could notice pregnancy signs after 8-12 weeks of gestation, and deliberately begin to consume folic acid supplements [10-16], but it seems a day after the fair. It should be advised to consume folate before the critical period of 4 weeks after gestation when neural tubes are formed and closed. However, most Japanese would like to consume nutrients from food, not from chemically-synthesized folic acid supplements, in view of food security and safety. Furthermore, Japanese women would be anxious and reluctant to consume supplements. Supplement consumption rates during early pregnancy period were 50%-70% in Japanese women [15,16] were lower than 70%-96% in western-country women [11-14]. Those rates before pregnancy were as low as 20%-30% not only in western countries but also Japan [10-16]. While the National Survey of Health and Nutrition (2014) reported dietary folate consumption from daily meals of young (potentially being pregnant) women aged 15-49 ranged from 232-243 μg/day on average [17], showing that approximately 50% were consuming less than 240 μg/day of recommended daily requirement (RDA) of Dietary Reference Intakes (DRIs) for Japanese (2015) [18]. Moreover, there would cause even greater folate insufficiency during pregnancy vs 480 μg/day of RDA while higher folate consumption is really needed. In the present study, we recruited potentially pregnant Japanese university women students, first studied consumption of folate intake from regular meals, and conducted a randomized controlled trial (RCT) using fermented milk fortified with lower dose of folic acid (200 μg/100 mL of FF milk) with Bifidobacterium breve to examine serum folate concentrations stratified by methylenetetrahydrofolate reductase (MTHFR) C667T to secure healthy serum.

Materials and Methods

We invited 154 non-pregnant university women students (aged 18-19 years) attending a university located in N City, Aichi Prefecture, Japan. After excluding 11 subjects (9 unavailable blood sampling after intervention, 2 having hemolysis in blood samples) from analysis, but including 4 subjects having lower compliance in the experimental group according to intent-to-treat principle, 143 subjects were included in the trial. Neither the experimental nor control group subjects did not have habits of consuming folic acid supplements.

Ethical issues

Protocol was submitted to the Ethics Committee of Nagoya University of Arts and Sciences (#101) and approved. Written information was fully given to the subjects, and written consent was obtained from each subject.

Study design

An RCT was conducted, after stratifying subjects according to MTHFR C677T genotype (CC wild type, CT hetero type and TT (mutant type), and randomly allocating them into the experimental group or control group (Figure 1). The experimental group was recommended to from October - November 2014, and the control subjects were advised to only consume regular meals.

vitamins-minerals-RCT-study

Figure 1: Diagram of RCT study.

Subjects’ physical/anthropometric characteristics

Height and weight were measured, and body mass index (BMI=kg/m2) was calculated. Residential type, smoking, drinking habits, and consumption of vitamins and supplements were inquired.

FF milk

As experimental food, we used FF milk (a commercially available container of fermented milk fortified with folic acid 200 μg/100 mL with Bifidobacterium breve (Yakult Co. Ltd). The ingredients in detail were shown in Table 1.

Ingredient Content/100 mL
Energy (Kcal) 49
Protein (g) 3.2
Fat (g) 0.1
Carbohydrate (g) 10.6
Dietary fiber (g) 2.5
Sodium (mg) 40
Calcium (mg) 100
Iron (mg) 4
Vitamin B6 (mg) 1.2
Vitamin B12 (μg) 2.4
Vitamin E (mg) 8
Folic acid (μg) 200

Table 1: Folic acid-fortified fermented milk with Bifidobacterium breve.

We estimated 340 μg of dietary folate equivalent (DFE) for folic acid 200 μg multiplying by 1.7 [6,19,20].

Assessment of dietary intake

At baseline and after intervention, a validity and reproducibilityverified self-administered food frequency questionnaire (FFQ) was adopted to survey habitual dietary intake for the past one month [21]. Calculation of nutrients was based on weighed contents of food and food group density method, we computed energy-adjusted (/1,000 kcal) intakes of folate and related nutrients (including fats, protein, carbohydrate, Vitamin B6 and Vitamin B12) to adjust the influence of body size and level of physical exercise.

Folate intakes were evaluated in reference to 200 μg/day of estimated average requirement (EAR) (when non-pregnant), 400 μg/day (when pregnant) appearing in the DRIs for Japanese (2015) [18].

Analyses of blood biomarkers

Using morning fasting blood samples, serum folic acid was analyzed according to chemiluminescence immunoassay (CLIA) at a commercial laboratory of BML (BioMedical Laboratory). Folate levels were evaluated according the cutoff level anemia [22,23], or 24].

Genetic polymorphism analyses

Utilizing swabbed oral membranes, MTHFR polymorphism (C677T) was determined by polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) analysis on a 3% agarose gel. The following sense and antisense primers were used: 5’ TATTGGCAGGTTACCCCAAA3’ and 5’ CTCACCTGGATGGGAAAGAT3’. The PCR product (208 bp) was digested with restriction enzyme (HinfI) at C677T, resulting in 85 and 123 bp bands for mutant homozygote, 85, 123, and 208 bp bands for heterozygote, and 208 bp band for wild- type homozygote.

Statistical analyses

Hardy-Weinberg equilibriums of MTHFR genetic polymorphisms were verified by χ2 test. Distributions of serum folate values were skewed, and natural log-transformation was adopted. χ2 test or Fisher’s exact probability test was used for analyses of discrete variables. Arithmetic mean [standard deviation: SD] was calculated for normally distributed parameters, while geometric mean [SD] for natural logtransformed variables. One-way analysis of variance (ANOVA) was used to verify multiple group comparisons, and repeated ANOVA to examine baseline vs post-intervention comparisons. Pearson productmoment correlation coefficients (CCs) were calculated to test associations between folate intakes (nutrition-density method) and natural log-transformed serum folate concentrations.

Statistical analyses were conducted using SPSS Statistics ver. 20, and p

Results

Baseline anthropometric characteristics and lifestyle habits

Frequencies of MTHFR C677T genetic polymorphism of all subjects (143) were 36 (26.4%) for CC type, 75 (52.1%) for CT type, and 32 (21.5%) for TT type, and were distributed within Hardy-Weinberg equilibrium.

BMIs of all subjects were 20.1 (1.9) kg/m2 (mean SD) (Table 2).

Characteristics All (n=143) CC type (n=36) CT type (n=75) TT type (n=32) P1)  
Age (yrs) 18 (18,19) 18 (18,19) 18 (18,19) 18 (18,19) n.s.  
Height (cm) 157.9 (5.7) 156.9 (6.2) 157.4(7.3) 158.5 [5.3 n.s.  
Weight (kg) 50.2 (6.3) 50.2 (8.3) 50 (6.6) 50.5 (5.4) n.s.  
BMI (kg/m2) 20.1 (1.9) 20.4 (1.9) 20.3 (4.2) 20.1 (1.8) n.s.  
Life style habits
Smoking
Yes (n (%)) 1 (0.7) 1 (2.8) 0 (0) 0 (0) n.s.  
No (n (%)) 140 (97.9) 34 (94.4) 74 (98.7) 32 (100) n.s.  
Non-response (n (%)) 2 (1.4) 1 (2.8) 1 (1.3) 0 (0) n.s.  
Alcohol
Yes (n (%)) 1 (0.7) 1 (2.8) 0 (0) 0 (0) n.s.  
No (n (%)) 140 (97.9) 34 (94.4) 74 (98.7) 32 (100) n.s.  
Non-response (n (%)) 2 (1.4) 1 (2.8) 1 (1.3) 0 (0) n.s.  
Intake Supplements  
Yes (n (%)) 16 (11.1) 4 (11.1) 9 (12.0) 3 (9.4) n.s.  
No (n (%)) 125 (87.4) 32 (88.9) 64 (85.3) 29 (90.6) n.s.  
Non-response (n (%)) 2 (1.3) 0 (0)  2 (2.7) 0 (0) n.s.  
Nutrient Intake  
Total energy (kcal/day) 1,559 (367) 1,556(379) 1,591(367) 1,487 (356) n.s.  
Vitamin B6(mg/1000kcal/day) 0.61 (0.14) 0.61 (0.14) 0.61 (0.13) 0.61 (0.18) n.s.  
Vitamin B12(μg/1000kcal/day) 2.6 (1.1) 2.8 (1.0) 2.6 (1.2) 2.4 (1.1) n.s.  
Dietary folate (μg/day) 246 (97) 251 (93) 246 (106) 240 (82) n.s.  
Dietary folate (μg/1000kcal/day) 159 (59) 165 (68) 153 (46) 169 (73) n.s.  
Serum folate  
Serum folate (ng/mL)2) 98 (1.4) 12.1 (1.3)a,b 9.9 (1.4)a,c 7.7 (1.4)a,c <0.001  
Serum folate <7 ng/mL (n (%)) 19 (13.3) 1 (2.8) 10 (13.3) 8 (25.0) 0.026  
1)one-way analysis of variance with post hoc Bonferroni Test: statistically significantacross the same characters. χ2test for discrete variables.  
2)Geometric mean [standard deviation]  

Table 2: Anthropometric characteristics, nutrient intake and serum folate concentrations by MTHFR genetic polymorphism at baseline.

Proportions of non- smokers and non-drinkers were approximately 98%, because they are younger than 20 years old (the age allowed to drink and smoke, in Japan). No significant differences were observed in anthropometric characteristics or lifestyle habits across three MTHFR genotypes.

Average energy intake for all subjects was 1,559 (367) kcal/day, Vitamin B6 0.61 (0.14) mg/1,000 kcal/day, Vitamin B12 2.6 (1.1) μg/ 1,000 kcal/day, and dietary folate 159 (59) μg/1,000 kcal/day. None of energy or nutrients were significantly different across MTHFR genetic polymorphisms (Table 3).

  Experimental group Control group P1)
CC type (n=16) CT type (n=41) TT type (n=16) CC type (n=20) CT type (n=34) TT type (n=16)
Total energy (kcal/day)  
  Baseline 1629 (383) 1577 (385) 1552 (445) 1497 (375) 1607
(349)
1421 (235) n.s.
Post-intervention 1627 (419) 1563 (407) 1570 (410) 1534
(395)
1370
(417)
1440 (407) n.s.
P2) n.s. n.s. n.s. n.s. 0.001 n.s.  
Folate (g/1000 kcal/day) 137
(31)
161
(46)
167 (89) 187
(81)
143
(44)
170
(56)
n.s.
Post-intervention 375
(83)
a,b,c
395 (87)
D,e,f
419 (136) G,h,i 167
(51) a,d,g
149
(58)
B,e,h
170 (41)
c,f,i
<0.001
P2)   <0.001 <0.001 <0.001 n.s. n.s. n.s.
  1. One-way analysis of variance with post hoc Bonferroni Test: statistically significant across the same characters.
  2. Comparison between baseline vs post-intervention across the same MTHFR genotypes: paired t-test.
  3. Dietary folate
  4. Experimental group: dietary folate+dietary folate equivalent for folic acid, Control group: dietary folate.

Table 3: Comparison of baseline vs post-intervention folate consumption by MTHFR genetic polymorphism in the experimental group and control group (/1,000 Kcal).

Serum folate levels were 9.8 (1.4) ng/mL on average, and 12.1 (1.3) ng/mL for CC type, 9.9 (1.4) ng/mL for CT type, and 7.7(1.4) ng/mL for TT type, being statistically significant different across MTHFR genotypes, and a significant trend of CC type>CT type>TT type (p<0.001).

As a whole, there were 19 (13.3%) having serum folate level lower than 7 ng/mL of the reference value of NTDs. There were 1 (2.8%) for CC type, 10 (13.3%) for CT type, and 8 (25.0%) for TT type, showing a statistically significant trend by MTHFR genotype (p=0.026). Of note, one-quarter subjects of TT type were at risk of NTDs.

Differences of folate consumption and serum folate concentrations between baseline and after intervention

Intake of folate at baseline and after intervention: At baseline, no differences were noted for folate intakes in the experimental group (n=73) and control group (n=70) across MTHFR genetic polymorphisms. However, after intervention, folate intakes in the experimental group were consistently greater than the control group (p<0.001). As a whole, approximately 2.5-fold increase (p<0.001) was observed in the experimental group. The changes by MTHFR genotype were as follows: 137 (31] 375 (83) μg/1,000 kcal/day for CC type, 161 (46) 395 (87) μg/1,000 kcal/day for CT type, 167 (89) 419 (136) μg/ 1,000 kcal/day for TT type, but there were no discrepancies in those increments by genetic polymorphism.

In the control group, there were no differences in the comparison of baseline vs post- intervention by MTHFR genotype.

Serum folate concentrations at baseline and after intervention: At baseline, there were no differences in serum folate concentrations within the same genetic polymorphisms in the experimental group and control group. However, serum folate levels in CC type were consistently greater than TT type in the experimental group and control group. In the experimental group, serum folate concentrations increased from baseline to post-for CT type, and 7.9 (1.4) 11.0 (1.3) ng/mL for TT type, manifesting a statistically significant increase. The change rates were 152.3 (1.4) % for CC type, 150.8 (1.4)% for CT type and 144.2 (1.3)% for TT type, without any statistical significant difference by MTHFR genetic polymorphism (Table 4).

  Experimental group Control group P1)
CC type (n=16) CT type (n=41) TT type (n=16) CC type (n=20) CT type (n=34) TT type (n=16)
Baseline 12.2 (1.3)a,b 9.8 (1.5) 7.9 (1.4)a,c 12.0(1.4)c,d 10.1(1.4) 7.5(1.4)b,d <0.001
Post-intervention 18.5 (1.3)a,b,c,d 14.7 (1.3)e,f,g 11.0 (1.3)a 10.6(1.4)b,e 9.6(1.4)c,f 8.0(1.4)d,g <0.001
Change rate (%) 152.3 (1.4)a,b,c 150.8(1.4)d,e,f 144.2 (1.3)g,h 88.3(1.4)a,d,g 95.6(1.3)b,e,h 106.7(1.4)c,f <0.001
P2) <0.001 <0.001 <0.001 n.s. n.s. n.s.  
Anti-In value was presented for serum folate.
  1. One-way analysis of variance with post hoc Bonferroni Test:statistically significantacross the same characters.
  2. Comparison between baseline vs post-intervention across the same MTHFR genotypes: paired t-test.

Table 4: Serum folate concentrations by MTHFR genetic polymorphism in the experimental group and control group.

In the control group, there were no baseline vs post-intervention differences or change rates in folate concentrations by MTHFR genetic polymorphism.

Associations of folate intake with serum folate levels at baseline and after intervention: At baseline, there were no significant Pearson correlation coefficients between energy- adjusted folate intakes and log-transformed serum folate concentrations by MTHFR genetic polymorphism for all subjects (Figure 2).

vitamins-minerals-energy-adjusted

Figure 2: Associations between energy-adjusted folate intake and serum folate concentrations (ln value) by MTHFR genetic polymorphism at baseline and post-intervention. 1) Folate intake in the post-intervention=dietary folate+dietary folate equivalent for folic acid.

At baseline, there were no differentials in dietary folate consumption across MTHFR genetic polymorphisms in all participants, but serum folate concentrations revealed significant discrepancies across MTHFR genotypes with a significant trend of CC type>CT type>TT type, being compatible with the results of CC type, CT type>TT type [25,26], CC type>CT type, TT type [27], and CC type>TT type [28]. There were some differences in the relationships, but was at least a common trend of CC type>TT type, indicating that there was variation of folate metabolism according to MTHFR genetic polymorphism. In the experimental group, serum folate increased to 152.3% for CC type, 150.8% for CT type, and 144.2% for TT type after the intervention of FF milk, all the subjects exceeded the reference value of folate (4 ng/mL) of megaloblastic anemia, irrespectively of MTHFR genotypes. The number of subjects having serum folate concentrations lower than the reference value of NTDs (7 ng/mL) decreased from 10 (13.7%) 2 (2.7%). Moreover, the serum folate levels of the subjects were just below the reference value: that is, 6.7 ng/mL and 6.8 ng/mL, suggesting that the present intervention using FF milk containing 200 μg of folic acid manifested satisfactory results for the risk reduction of NTDs.

After intervention, as a whole, Pearson correlation coefficient (r=0.463) was statistically significant (p<0.001): r=0.652 (p<0.001) for CC type, r=0.512 (p<0.001) for CT type, and r=0.378 (p<0.05) for TT type.

Frequency of serum folate concentrations<7 ng/mL at baseline and after intervention: In the experimental group, 10 subjects (13.7%) with serum folate levels <7 ng/mL at baseline decreased to 2 (2.7%) after intervention (p=0.031) (Table 5): from 0 subject zero in CC type, from 6 subjects (14.6%) 1 (2.4%) in CT type, and from 4 subjects (25.0%) 1 (6.1%) in TT type. In the control group, there were no differences in the frequency at baseline vs post-intervention by genotype.

  Experimental group Control group P1)
Total (n=73) CC type (n=16) CT type (n=41) TT type (n=16) P1) Total (n=70) CC type (n=20) CT type (n=34) TT type (n=16)
  n (%) n (%) n (%) n (%)   n (%) n (%) n (%) n (%)    
Baseline 10 (13.7) 0 (0) 6 (14.6) 4 (25.0) n.s. 9 (12.9) 1 (5.0) 4 (11.8) 4 (25.0) n.s.  
Post-intervention 2 (2.7) 0 (0) 1 (2.4) 1 (6.3) n.s. 11 (15.7) 2 (10.0) 5 (14.7) 4 (25.0) n.s.  
P2) 0.031   n.s n.s   n.s. n.s. n.s. n.s.  
χ2 test
Comparison between baseline vs post-intervention across the same MTHFR genotypes: Fisher’s exact probability test.

Table 5: Number of subjects having serum folate concentrations <7 ng/Ml.

Discussion

Stratifying 143 women university students by MTHFR genetic polymorphism C667T, we conducted an RCT using FF milk containing 200 μg of folic acid, and studied its effects on serum folate concentrations. At baseline, average dietary folate intake was 246 (98) μg/day for all subjects, and no differences were noted in the comparisons between the experimental and control groups. Postintervention serum folate levels showed approximately 1.5-fold increase in the experimental group. The intervention manifested onefifth reduction (from 10 2) in number of the subjects having serum folate levels lower than the reference value of NTDs (7 ng/mL). In addition to regular desirable consumption of food/meals, FF milk could contribute to reduce the onset of NTDs in all MTHFR genotypes (Figure 1).

In order to clarify a minimum effective dose of folic acid for prevention of NTDs, Daly et al. [29] carried out an RCT using supplements containing 100 μg, 200 μg or 400 μg of folic acid or placebo for approximately 6 months, and evaluated the effects using 400 ng/mL of RBCs folate concentration as reference. They concluded that 400 μg of folic acid was effective for prevention of NTDs but was subjected to extra monetary cost, while 200 μg/day appeared favorable in terms of cost-effectiveness, cost-benefit, and risk-benefit appraisals, as also reviewed by Dary et al. [24] Furthermore, even a supplement containing 100 μg of folic acid when consumed continuously could contribute to reduce the onset of NTDs. When looking into Japanese intervention literature, Hiraoka et al. [27] conducted an intervention study in women university students using supplements containing 200 μg/day or 400 μg/day of folic acid for four weeks, and observed elevated serum folate concentrations to 140% or 173% on average after the intervention. Kawashima et al. [30] conducted a double- blind placebo controlled trial in women aged 20’s applying a vegetable and fruit-mixed juice capsule containing 420 μg/day of folate in addition to regular meals for 28 days, and observed an increased serum folate concentration of 22.4 (1.26) ng/mL (174% elevation compared with baseline) and a decreased pHcy level of 8.14 (0.44) nmoL/mL (81.1% of baseline), suggesting that the intervention could reduce the onset of NTDs as well as megaloblastic anemia. These observations were equivalent to the meta-analysis observations by Marchetta et al. [31], showing that 1,070 nmoL/L of RBCs folate level (the lower limit for prevention of NTDs) was attained by consumption of 450 μg/day of folate from natural food items. For the purpose of international comparisons, we applied 1.7 for DFE in the present study. While, in Japan, 2.0 of DFE was adopted according to the report by Fukuwatari et al. [32] Thus, FF milk containing 200 μg of folic acid was considered to be equivalent to dietary folate of 340 or 400 μg/day, and approximately equal to the folate intakes estimated by Kawashima et al. [30] and Marchetta et al. [31] Young Japanese women, even in conception, were reported to have insufficient knowledge about NTDs, associations of folate with risk of NTDs, importance of periconceptional folate consumption. Recommendations to consume 400 μg or more of folic acid were issued to women potentially expecting and women in early gestation, but only 20 - 30% of women deliberately performed parenthood. Because fetal neural tube closes before - during the early pregnancy, desirable folate nutrition should be provided during the critical period. Many countries, including US, have launched a population approach serving cereals (wheat, maize, flour) fortified with folic acid. Thus, folic acid fortification to rice (Japanese staple food) may be an option, but rice consumption has been drastically declining and cannot be chosen.

Accordingly, a recommendation to partly replace milk with FF milk seems acceptable because Food Balance Guide, Japan recommended to regularly consume a given amount of milk. The strategy would not only reduce the risk of NTDs but also increase calcium consumption, which is known to be insufficient in Japanese. Japanese would prefer to consume nutrients from palatable food, but not from supplements. In fact, there are wide varieties of quality of supplements (including ingredients), and some of them appear without guarantee of quality and safety. Thus, the National Institute of Health and Nutrition, Japan issued 3-step recommendations that women should consume folate first from various food items/meals, then folic acid-fortified foods, or foods with health claims, then folic acid supplements, when there actually exists folate intake deficiency [33]. Using the individual information of MTHFR genotype, tailor-made effective and efficient health care/prevention using palatable food, without side effects, could be implemented. There are weaknesses/limitations in the present trial. The study subjects were limited to women university students with rather small in number and short intervention period of time. We did not assayed folate levels of the RBCs and pHcy. There might be some lower adherence to the regimen in the experimental group. Certain level of contamination might be intervened in the control group although we asked the subjects not to consume FF milk. We should explore possible effects of food (other than milk) containing/fortified with folic acid because relative bioavailability differs by food item. Further tailor-made trials by MTHFR genotype are warranted to optimize and maximize the effect of folate/folic acid to reduce the risk of NTDs without side effects. In conclusion, there were no discrepancies in consumption of folate by MTHFR C667T genetic polymorphism, but serum folate concentrations were CC type>CT type>TT type at baseline. Consumption of FF milk containing 200 μg/day sufficiently increased serum folate concentrations up to the reference value of NTDs in university women students, and seemed to effectively and efficiently decrease the risk of NTDs. FF milk could be selected as food before-during the early period of gestation in addition to regular favorable meals for prevention of NTDs without any harm.

Acknowledgment

We are grateful to the subjects participated in the present intervention trial, and to Yakult Co. Ltd.

Conflict of Interest

Fermented milk fortified with 200 μg/day of folic acid was provided by a commercial company (Yakult, Co. Ltd.) free of charge, but we declare that there was no conflict of interest.

References

Citation: Mitsukuchi C, Kumagai Y, Yasutomo H, Ito Y, Kitagawa M, et al. (2017) Effects of Folic Acid-Fortified Milk on Serum Folate Levels in Japanese Young Women a Randomized Controlled Trial Stratified by Methylenetetrahydrofolate Reductase Genetic Polymorphism C677T. Vitam Miner 6: 170. DOI: 10.4172/2376-1318.1000170

Copyright: © 2017 Mitsukuchi C, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Post your comment

captcha   Reload  Can't read the image? click here to refresh