alexa Evaluation of Expression Pattern of Vascular Endothelial Growth Factor (VEGF) and Interleukin-23 (IL-23) Genes in Human Colorectal Tumors

ISSN: 1747-0862

Journal of Molecular and Genetic Medicine

Reach Us +44-1904-929220

Evaluation of Expression Pattern of Vascular Endothelial Growth Factor (VEGF) and Interleukin-23 (IL-23) Genes in Human Colorectal Tumors

Rezaei FM1,7, Hashemzadeh S2,7, Zaimy MA3, Feizi MH4, Pouladi N5, Kafil6, Leila Rostamizadeh HS1 and Sakhinia E1,7,8*
1Department of Biochemistry and Clinical Laboratories, Division of Medical Genetics, Tabriz University of Medical Sciences, Tabriz, Iran
2Department of General and Vascular Surgery, Tabriz University of Medical Sciences, Tabriz, Iran
3Department of Medical Genetics, School of Medicine, Ilam University of Medical Sciences, Iran
4Department of Animal Biology, University of Tabriz, Tabriz, Iran
5Department of Biology, Azarbaijan Shahid Madani University, Tabriz, Iran
6Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
7Tuberculosis and Lung Disease Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
8Tabriz Genetic Analysis Center (TGAC), Tabriz University of Medical Sciences, Tabriz, Iran
*Corresponding Author: Sakhinia E, Tabriz Genetic Analysis Center (TGAC), Tabriz University of Medical Sciences, Tabriz, Iran, Tel: 17 3221 2392, Email: [email protected]

Received Date: Jan 17, 2018 / Accepted Date: Feb 08, 2018 / Published Date: Feb 12, 2018

Abstract

Background: There is a very long interval between the time of tumor initiation and diagnosis of CRCs. So, by early screening by molecular markers, individuals can be diagnosed in a much more convenient time to start the therapies. Among key factors deregulated in advanced CRC, are VEGF (vascular endothelial growth factor) and interleukin-23, which have critical roles in tumor angiogenesis and growth respectively.
Objectives: The main purpose of the study was to elucidate the patterns of VEGF-A and IL-23 (IL-23p19) molecular expression in CRC.
Material and methods: 47 human colorectal cancer tissues and 47 matched tumor-free margin tissues were gathered during surgery. The mRNA expression levels of VEGF-A and IL-23p19 were examined by real-time quantitative polymers chain reaction (qPCR).
Results: The mRNA expression levels of VEGF-A and IL-23p19 were higher in tumor tissues than in the tumor-free margin (control) (p=0.008 and p=0.002, respectively). Though, there was no important association between the mRNA expression levels of VEGF-A and IL-23p19 with clinicopathological features. There was also a positive correlation between these 2 genes expression levels.
Conclusion: The analysis of IL23p19 and VEGF-A genes expression could be considered as a biomarker for screening CRC patients and are suggested to be used for diagnosis. Thus, collectively, the high expression level of VEGF-A and IL-23p19 can be considered as a risk factor for CRC carcinogenesis, contributing to high proliferation and invasive properties of the tumor.

Keywords: Colorectal cancer; Interleukin-23 (IL-23); Vascular endothelial growth factor (VEGF); Quantitative real-time PCR (qRT-PCR)

Introduction

Colorectal cancer (CRC), colon cancer, or rectal cancer that, also known as bowel cancer is any malignancy that affects the colon and the rectum. In colorectal cancer, tumor progression is a complex phenomenon consisting many different steps from the beginning of tumor generation by genetic changes to development and metastasis. In primary steps, genetic variations are involved in tumoral over-proliferation and subsistence, while tumor development and metastasis depend on various signaling pathways for the tumor cells to acquire invasive properties and eventually colonize secondary organs [1-11].

Growing body of evidence suggests a critical role for Vascular endothelial growth factor (VEGF) as the key mediator of angiogenesis (the formation of new blood vessels) in different kinds of carcinogenesis, as well as chronic inflammatory diseases like IBD, asthma and psoriasis [12-14].

Among potent inflammatory components, Interleukin-23 (IL-23) and IL-17, stimulated by tumors lactic acid secretion [15]. Interleukin-23 is an important heterodimer molecule which is formed by linkage of IL-23-specific subunit, IL-23p19 (IL-23a), and a subunit shared with IL-12 (IL-12p40) [16]. IL-23 is one of the IL-12 (interleukin-12) superfamily’s member [17]. It has been confirmed that, separately from its immunity roles (like IL-12), IL-23 promotes T helper 17 (Th17) cells maturation and consequently the secretion of IL-17, therefore leading to the development of chronic inflammation and tumor growth [17-19]. Although the mechanisms are not absolutely obvious, the activity of regulatory T (Tregs) cells and Th17 rises by IL-23, and according to this procedure, the activity of STAT3 (Signal Transducer and Activator of Transcription 3) is affected within cancerous cells and leads to tumor progression [20,21].

It has been previously suggested that the role of chronic inflammation in tumor development is through the induction of genetic alterations [22]. However, recent findings provide evidence of the straight effect of inflammation on cancer development [23].

The aim of this study was to examine the expression level of IL-23p19 and VEGF-A at mRNA level among individuals with colorectal cancer. Moreover, we performed the study to conclude whether these 2 genes might be helpful in differentiating the limit of the margin with the tumor of CRC.

Material and Methods

Study population

Tumor samples and matched tumor-free margin were gathered from 47 CRC patients that had undergone resection of the tumor by surgeries in Imam Reza hospital of Tabriz, Iran. All of the patients have given written consent and the protocol of the study was approved and accepted by the Ethics Committee. The age of the patients ranged from 23 to 76 years (mean age: 55.4 years), and the samples consisted of 27 males and 20 females. The subjects were chosen based on clinicopathological factors (Age, Gender, Tumor size, Histology, Depth of tumor, metastasis, Venous invasion, AJCC stage, classification, and Liver metastasis) that was gained over patient interviews and clinical documents.

Sample preparation

Confirmed histopathologically carcinoma areas used to take tumor samples, and mucosa species were obtained from unaffected area at the furthest distance from tumor place (>2 cm from tumor). The tissues were gathered instantly after resection and placed directly into RNAlater (Qiagen, Germany), then stored at -80°C. Total RNA was extracted by using RNeasyTMmini kit (Qiagen, Germany) as suggested by the manufacturer. The quantity and quality of the RNA samples was examined by Nanodrop and gel electrophoresis, Respectively. In the Next step cDNA library was made using RT-PCR. cDNA samples were synthesized in 20 μL volume using a random hexamer primer and reverse transcriptase.

Reverse Transcriptase PCR (RT-PCR)

PCR primers were designed and blasted using GeneRunner software and NCBI blast (Table 1). A specific RT-PCR was done for GAPDH, VEGF-A, and IL-23p19 genes with all samples. For each sample, total reaction volume was 15 μL, counting 7.5 μL red master mix (Ampliqon, Denmark), 0.3 μL from each primer (forward and reverse), 2 μL cDNA, and 4.9 μL water. Then, samples were located in a thermal cycler (Eppendorf, Germany) with the following program: 4 minute at 95°C, then followed 35 cycles at 94°C for 25 second, 56°C for 25 second for VEGF-A/57°C for 25 second for IL-23p19/58°C for 25 second for GAPDH, 72°C for 25 second, and finally ended with 1 cycle for terminal extension at 72°C for 4 minute. For internal housekeeping gene, GAPDH was used. PCR products were run on a 2% agarose gel and then were encountered to ultraviolet light. The image showed specific bands for VEGF-A, IL-23p19 and GAPDH genes with 263 bp, 173 bp, and 219 bp, respectively.

Genes Forward Primers Reverse Primers
GAPDH CATGGCCTCCAAGGAGTAAG GCTTGAGCACAGGGTACTTTA
VEGF-A CTCCCCAGCACACATTCC ACGGATAAACAGTAGCACCA
IL-23p19 CGTCTCCTTCTCCGCTTCAA GTGCCTGGGGTGGTAGATTT

Table 1: Primers used for PCR.

Quantitative real-time PCR (qPCR)

The gene expressions level of VEGF-A and IL-23p19 were assessed by SYBR Green qPCR, GAPDH was considered as the reference gene.

qPCR reactions were done in a final volume of 15 μL (4 μL of each sample of cDNA, 7.5 μL SYBR Green Master Mix (Takara) and 0.3 μL of forward and reverse primers of each gene and 2.9 of μL of water). PCR conditions for qPCR were: 5 minutes at 95°C ‚ then 40 cycles: 30 second at 95°C‚ 40 second at 60°C‚ 35 second at 72°C, tailed with a final elongation step for 5 minutes at 72°C. Each sample was tested in duplicate, and the standard curve, which was measured by 4 serial dilutions, used to interpreted the mean Ct values into a relative concentration unit. NTC (None Template Control) was considered in each reaction. Lastly, GAPDH expression were used to normalize relative concentrations of IL-23p19 and VEGF-A. IL-23p19 and VEGF-A mRNA levels in the normal mucosa and tumor tissue group were compared and analyzed the relation among IL-23p19 and VEGF-A expression, and clinicopathological characters.

Statistical analysis

Pfaffl formula used to evaluate the expression of IL-23p19 and VEGF-A in CRC tissues relative to adjacent normal mucosa. The statistical alterations in VEGF-A and IL-23p19 expression in tumor and non-tumor counterparts were evaluated by the paired t-test. Also, for considering the connection between the VEGF-A and the IL-23p19 expression level in each patient, Pearson correlation coefficient was used. The Kolmogorov-Smirnov z test for assessing the normality of statistics and the Levene’s test used for assessing the equality of variances. The association between the expression of VEGF-A and IL-23p19 and clinicopathological characters were examined by the t-test between 2 groups and one-way ANOVA test for more than 2 groups. All tests were accomplished using SPSS (v. 16). Moreover, ROC (Receiver Operating Characteristic) curves were created using SigmaPlot to calculate VEGF-A and IL-23p19 abilities as well as the specificity and sensitivity of them to separate CRC tissues from non-tumor tissues.

Results

Expression levels of VEGF-A and IL-23p19 in CRC tissues

Analysis of q-PCR for both VEGF-A and IL-23p19 in 47 pairs of tumoral tissues and matched tumor-free counterparts was done. The outcomes indicated that VEGF-A expression levels were significantly raised in tumoral tissues in comparison to the normal matches (p ≤ 0.008).

A comparison of VEGF expression level differences is demonstrated for tumor and adjacent normal mucosa of each patient in Figure 1. The value of ΔCt (mean ±SD) for VEGF-A was 5.07 ±2.36 in tumoral tissues and 6.30 ±2.12 in their matching tumor-free tissues. The variance of VEGF-A gene expression was high in the great number of the individuals with CRC, but in some of them the levels of the expression were similar (Figure 2).

molecular-genetic-medicine-tumor-marginal

Figure 1: Comparison of the expression level of VEGF-A in tumor and marginal samples (T- tumor; M- margin).

molecular-genetic-medicine-Expression-level

Figure 2: Expression level of VEGF-A in marginal samples (T- tumor; Mmargin).

The t-test and one-way ANOVA test indicated no association between VEGF-A expression level and clinicopathological factors (Table 2). Also, the analysis showed that IL-23p19 mRNA expression level in tumor tissues was upper than those in tumor-free counterparts (p ≤ 0.002). A comparison of differences in the expression levels between the IL-23p19 gene in the tumor and the tumor-free adjacent mucosa is demonstrated for each patient in Figure 3. The value of ΔCt (mean ± SD) was 5.06 ±1.49 in tumoral tissues and 5.99 ± 1.25 in their matching tumor-free tissues. The variance of IL-23p19 expression was high in more individuals with CRC, but in some of them the expression levels were similar (Figure 4). Also, no association between the mRNA expression of IL-23p19 gene and clinicopathological aspects was detected (Table 3). According to the results of the Pearson correlation coefficient, a correlation between VEGF-A and IL-23p19 gene expression was detected (r=0.44; p ≤ 0.002). This state means that a rise in mRNA level of VEGF-A in each individual was concurrent with a rise in IL-23p19 mRNA level.

molecular-genetic-medicine-tumor-marginal

Figure 3: Comparison of the expression level of IL-23p19 in tumor and marginal samples (T-tumor; M- margin).

molecular-genetic-medicine-marginal

Figure 4: Expression level of IL-23p19 in marginal samples (T-tumor; Mmargin).

Clinicopathologic Variables Number VEGF-A, ΔCt P value
Age
<55 20 4.82 ± 1.50 0.503
>55 20 5.52 ± 3.18
Gender      
Male 27 5.18 ± 2.73 0.868
Female 20 4.93 ± 1.80
Tumor size (cm)
<3 3 5.09 ± 1.91 0.714
≥3 37 5.18 ± 2.54
Histology
Well 23 4.72 ± 1.58 0.752
moderate 13 5.74 ± 3.65
poor 4 5.89 ± 2.13
Depth
T2 , T3 12 4.55 ± 1.10 0.796
T4 28 5.43 ± 2.85
Lymph node metastasis
Absent 16 4.79 ± 1.75 0.705
Present 24 5.42 ± 2.87
Venous invasion
Absent 11 4.66 ± .74 0.405
Present 29 5.36 ± 2.87
AJCC stage classification
I, II 14 4.82 ± 1.88 0.823
III, IV 26 5.36 ± 2.76
Liver metastasis
Absent 35 5.16 ± 2.63 0.416
Present 5 5.25 ± 1.08

Note: Data presented as mean ± SD; P-values obtained using T-Test and One-Way ANOVA test.

Table 2: VEGF-A gene expression and clinicopathological factors in 47 CRC patients.

Clinicopathologic Variables Number IL-23p19, ΔCt P value
Age
 <55 20 5.19 ± 1.45 0.808
 >55 20 4.93 ± .33
Gender
 Male 27 5.06 ± 1.56 0.617
 Female 20 5.05 ± 1.43
Tumor size (cm)
 <3 3 4.98 ± 2.42 0.817
 ≥3 37 5.07 ± 1.41
Histology
 Well 23 5.21 ± 1.32 0.359
 moderate 13 4.83 ± 1.75
 poor 4 4.96 ± 1.55
Depth
 T2 , T3 12 4.90 ± 1.58 0.540
 T4 28 5.13 ± 1.43
Lymph node metastasis
 Absent 16 5.26 ± 1.47 0.371
 Present 24 4.92 ± 1.47
Venous invasion
 Absent 11 5.16 ± 1.41 0.550
 Present 29 5.02 ± 1.50
AJCC stage classification
 I, II 14 5.47 ± 1.42 0.107
 III, IV 26 4.84 ± 1.46
Liver metastasis
 Absent 35 5.09 ± 1.49 0.996
 Present 5 4.85 ± 1.33

Note: Data presented as mean ± SD; P-values obtained using T-Test and One-Way ANOVA test.

Table 3: IL-23p19 gene expression and clinicopathological factors in 47 CRC patients.

Potential of VEGF-A and IL-23p19 to be CRC tumor markers

After constructing the ROC (Receiver Operating Characteristic) curves, AUC (the area under the curve) was considered to assess the capability of VEGF-A and IL-23p19 mRNA expression levels and specificity and sensitivity of them to separate CRC from tumor-free tissue. According to the ROC curve investigation, ROC area (AUC) were 0.67, p ≤ 0.004 for both VEGF-A and IL-23p19 mRNAs (Figure 5). Sensitivity and specificity is presented at different cut-off points in the plot. A post-test from pre-test probability of 0.5 and cost ratio of 1.00 was prepared to determine the optimal cut-off value. For VEGF-A, the optimum cut-off point was <5.60 with 0.74 and 0.64 sensitivity and specificity, respectively and for IL-23p19, <6.01 with 0.79 and 0.49 sensitivity and specificity, respectively.

molecular-genetic-medicine-curve-detection

Figure 5: Receiver Operating Characteristic (ROC) curve in detection of CRC. The curve was automatically generated by the SigmaPlot software. The area under the ROC curve (AUC) is 0.67 out of 1.

Discussion

In the course of inflammation, the abundantly found angiogenic and inflammatory components may contribute to progression of the disease [24,25]. This process especially observed in IBD patients with possibility for CRC and suggests a critical connection between chronic inflammation and tumor growth [1,26].

The main goal of this study was to measure the mRNA expression levels of VEGF-A and IL-23p19 genes and assess their ability in differentiating the limit of the margin with the tumor of CRC. We accomplished a real-time PCR to quantity the relative expression of VEGF-A and IL-23p19 genes in total of 47 CRC patients. Our outcomes confirmed that the levels of VEGF-A and IL-23p19 mRNA expression increased considerably in cancer tumor tissues comparing to adjacent normal tissues. Also, we were unable to discover an important link between clinicopathological information and the mRNA expression levels of both genes. Colorectal carcinoid tumors have classified by The American Joint Council on Cancer (AJCC) [27] and the clinical characteristics of them (consist of depth, size, age, histology, gender, and metastasis of liver, venous and lymph node) have assessed in this investigation.

Although in colorectal cancer, the function of interleukin-23 is not absolutely obvious, its decisive function in inflammatory bowel diseases is pointed in several previous investigations [28-30]. Some of papers informed that IL-23 has anti-tumor action in murine tumor models [31-33]. Whereas in a study by Langowski et al. was shown that, IL-23 induced tumor development in a variety cancer types [19]. In agreement with our outcomes, an increased expression level of IL-23p19 was reported in a study by Stanilov et al. According to them, IL-23 acts negatively to cytotoxic T cells in terms of activity and abundancy in the transformed tissue. This lead to an upregulation of IL-23p19 in tumor cells. Therefore, the outcomes support the theory that demonstrating IL-23 as a promoting factor for tumor growth [34].

Besides, our results showed a positive correlation among the mRNA expression levels of IL-23p19 and VEGF-A. A possible reason is the stimulation of IL-23 and VEGF by STAT3, as it was already suggested in a study by Ljujic et al. They have assessed the serum level of IL-23 and expression of VEGF with ELISA and immunohistochemistry methods, respectively and their report is in accordance with our outcomes [35]. In the current study, VEGF-A mRNA was shown to be augmented in colorectal tumor tissues compared to normal mucosa, in accordance with former investigations [36,37]. Creation of new vessels by growth of former ones known as angiogenesis and is necessary for tumor growth. This procedure (angiogenesis) is because of the balance between an amount of angiogenic factors/inhibitors. VEGF is one of the main angiogenic mediators which is demonstrated to be upregulated in colorectal tumor [38-41]. In this investigation, VEGF-A overexpression in tumor tissues indicates that it has a fundamental part in the angiogenesis of CRC. These findings unfold extra indication for VEGF-A role in the carcinogenesis of CRC. The Avastatin/Bevacizumab (recombinant humanized VEGF-A monoclonal antibody) is used as a therapy for metastatic CRC [42].

Among CRC screening methods, CEA is a carcinoembryonic antigen and is measurable in the serum over a radiommunoassay [43]. Its serum level is high in a different type of cancers, especially epithelial tumors. Some environmental variants such as facility of test performing, effect on the CEA sensitivity and specificity [44-46]. In early stages of colon cancer, the sensitivity of CEA is low, and it rises with rising tumor stages [47]. In stage I and II of the disease, for a CEA >2.5 ng/Ml, the sensitivity and specificity were 36% and 87% respectively. Nevertheless, the amount of them are 74% and 83%, respectively in stage III and IV of the CRC [48]. Due to the weakness of the test for detecting the colorectal cancer in early stages, it is dedicated that the test is inappropriate for early tumor screening [49].

In current investigations for colorectal cancer screening, microarray analysis has been suggested [50-52]. But because of some complications for using this technique in routine diagnosis in laboratory, using molecular tests such as this study, could be helpful. Development of new clinical protocols, in which inhibitors of angiogenesis are used alongside conventional therapies such as chemotherapy/radiotherapy and also immunotherapy, are suggested. These inhibitors could be beneficial to be used in early stages to prevent early invasion and dissemination of tumor cells, as well as late stages to maintain the effect of therapy and prevent tumor recurrence [53].

Conclusion

In conclusion, this investigation indicated that VEGF-A and IL-23p19 are meaningfully upregulated in CRC tumoral tissues, suggesting that their high expression is elaborate in colorectal carcinogenesis. There is a very long interval between the time of tumor initiation and diagnosis of CRCs [54]. Therefore, by early screening taking advantage of newly developed molecular markers, individuals can be diagnosed in a much more convenient time to start the therapies that can eventually be more effective. VEGF-A and IL-23p19 are suggested to be such molecular markers with high sensitivity and specificity, to be used for the diagnosis of CRC. The high expression level of VEGF-A and IL 23p19 can be considered as a risk factor for CRC carcinogenesis, contributing to high proliferation and invasive properties of the tumor. Finally, deeper functional understanding of the role of VEGF-A and IL-23p19 seems to be a promising path to the early diagnosis and eventually more effective therapy of CRC.

Acknowledgments

The authors are grateful for support from the Tuberculosis and Lung Disease Research Center at Tabriz University of Medical Sciences, Iran. We would also like to thank patients for their helpful collaboration. This article was a part of a thesis submitted for MSc degree in the Faculty of Medicine, Tabriz University of Medical Sciences, Iran.

References

Citation: Rezaei FM, Hashemzadeh S, Zaimy MA, Feizi MH, Pouladi N, et al. (2018) Evaluation of Expression Pattern of Vascular Endothelial Growth Factor (VEGF) and Interleukin-23 (IL-23) Genes in Human Colorectal Tumors. J Mol Genet Med 12: 330 DOI: 10.4172/1747-0862.1000330

Copyright: © 2018 Rezaei FM, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Relevant Topics
Recommended Conferences
Article Usage
  • Total views: 3916
  • [From(publication date): 0-2018 - Oct 22, 2018]
  • Breakdown by view type
  • HTML page views: 3886
  • PDF downloads: 30

Post your comment

captcha   Reload  Can't read the image? click here to refresh