alexa Evidence of Irf4 Gene, Irf2, Irf8 Genes in an Invertebrate: The Sea Star Asterias rubens | OMICS International
ISSN: 2157-7633
Journal of Stem Cell Research & Therapy

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Evidence of Irf4 Gene, Irf2, Irf8 Genes in an Invertebrate: The Sea Star Asterias rubens

Michel Leclerc1* and Nicolas Kresdorn2

1Department of Cell Biology, Developmental Biology, Immunology, University of Orléans, Orléans, France

2GenXPro, Frankfurt, Germany

Corresponding Author:
Michel Leclerc
Department of Cell Biology
Developmental Biology, Immunology
University of Orléans, Orléans, France
E-mail: [email protected]

Received date: June 10, 2016; Accepted date: June 13, 2016; Published date: June 20, 2016

Citation: Leclerc M, Kresdorn N (2016) Evidence of Irf4 Gene, Irf2, Irf8 Genes in an Invertebrate: The Sea Star Asterias rubens. J Stem Cell Res Ther 6:340. doi:10.4172/2157-7633.1000340

Copyright: © 2016 Leclerc M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Stem Cell Research & Therapy

Abstract

IRF4 gene, IRF2 and IRF8 genes have been studied in sea star which is the only invertebrate, to possess these factors, playing a rôle in the immune adaptative immunity of A. rubens.

Keywords

IRF4 gene; Adaptative immune system; Immune cells

Introduction

IFR regulatory factors are ancient molecules conserved throughout the evolution of metazoans; they play a fundamental roles in innate and adaptative immune system [1]. To date 11 IRF family have been described in vertebrates and invertebrates [2].

Previous studies showed that in vertebrates, IRF4 was expressed in most types of immune cells, and had critical functions in B cell differenciation and immunoglobulin production [3].

Other studies on chicken found that IRF4 was mainly expressed in the bursa, bursal lymphocytes [4] and thymus [5]. Con A induced the expression of IRF4 in spleen cells [4].

As for IRF8 in mouse, it specifically bound to the expression of type I IFR and IFR-inducible MHC Class I genes. IRF2 had the same rôle and played a regulatory one in cells of the immune system. The aim of this work is the research of such factors in an invertebrate : the sea star Asterias rubens.

Materials and Methods

Sea stars were obtained from the Biology Institute (Gothenburgh University). Immunizations to HRP, genomic studies were already described [6]. After ligation of adapters for Illumina's GSII sequencing system, the cDNA was sequenced on the Illumina GSII platform sequencing. 1.100 bp from one side of the approximately 200 bp fragments sequences were assembled using Velvet [7].

Results

First results (a) concern significative IRF4 gene, found in immunized sea stars to HRP, when compared to mouse genome :

a) One Contig (Contig8452|m.8105) could be annotated via BLASTX to Mus musculus "Interferon regulatory factor 4" (IRF4), with an e-value of 3.2e-12. On an aligned region of 132 amino acids, 62 positive and 42 identical amino acids were found.

5'GCCAGGTGTGCATGTACCTGAGCCAGCCGTATGGAAGACGAGACTGCGTACTGCTCTCAATAAACTCCCTGACATCGATGAGGTCC ACGAGAAGACGCAACTAGACATCCCTGAACCCTATAGAGTCTACAGACTGCTGCCCAAAAAACCATCCAACAGCGCAATGAAAAACCGGCTT CCGACCAGCCCAACGTATGGCCAGCAGGACTCTCACCACAGGAGTGGACATTCGATGAGTAGTTACTCCGAGCGGTACAGTCCATATGACGTG CGACCTGGAACTTATTACACTGATGCATACGACCGGCAAAATCATTCGAGTTACCAACAACCGAGTCATCATTGGTATGATCCGAGCCGTCCC GGTGTTGATTATGGCTACCAGCAAGCATACACCAACTGTTACCCAAACAGCACAGCAGCCGACCTTGACATGATCAATGACGTCATCACACGT GACATCGATGGCAACCACGGCCACCATCCCCCAAGCCACGCCCACTACCCCCCAGGGAGCG3'

Second results (b) concern IRF2 gene in immunized and nonimmunized sea stars to HRP, when compared to mouse genome.

b) One Contig (Contig13667) could be annotated via BLASTX to Mus musculus "Interferon regulatory factor 2" (IRF2_MOUSE), with an e-value of 1.3e-39. On an aligned region of 144 amino acids, 101 positive and 75 identical amino acids were found.

5'TATGTAATCCATCAGCCCCCTCCGTACGTAGAGGGGTGAATAAGCAGCGCCTCTGTTGCATGGATATGGGGGTGGAGGGCTTATAACTGA TGCGGTTGGTGAGAGCGGGGATGGAAGGCTGGAAAGATTGCTAACTCTTGACGAGGTTGGGGAAGAGTACGGAGGAAGCTCGTGTCGCA TTGGGGAACTCTGATTGCTGAATGTAACACTCGAATGCCAAACATCTGTATTCATCTGTGATTGGCTGACTTCGTTATGCTCTTTCC AAAGCTCAGGTGAGAATTGTTGAGAAGTCGGATGATGCGTGGACGTAATACTGTCTCGAGTCTGGAGAATTCTTGATTGCACTTTG AATAAACTGGTCTTTGGCGATCTTCTGATAGTCCTACTGGTCTTCTTGTGTATCGTACTGCCATCACCCACAGGTTTGCTTTTTCTC GCCTTCTTCGGAATCAACTTGTAAATCTTGTAAGCATCGTTCCCTTTACTCTTCCCCTGATCCTTGACCTCAAGAATGTCCGGAAGTG AATTGATTGCACACCGGAAGTTCCTTTCCAGATCTTGGGATTCGCCTTCGGGCAATTGGACCGGGTCGTATTTTTTTGTATGGATGG CCCAAGCACGAAATAGCGATGCATCTTTGTCACAAGTCCAGCCGTGTCTTGCGGCATGTTTCCAGGGTATCTTAACCAACTGTTCC TTTTCATCCAACCACTCCAAGCCGGGTATGGTTTTCTCAACGATGTTACGGATGAGCCATGGTCGCAGACGCATCCTCTCGA CCGGGCGAACCGACG 3'

Third results (c) concern IRF8 gene in immunized and nonimmunized sea stars to HRP, when compared to mouse genome.

c) One Contig (c35396_g1_i1) could be annotated via BLASTX to Mus musculus "Interferon regulatory factor 8" from the Swissprot database (IRF8_MOUSE), with an e-value of 1e-12. On an aligned region of 53 amino acids, 42 positive and 33 identical amino acids were found

5'GGTAAATTCAAGCCAGGTGTGCATGTACCTGAGCCAGCCGTATGGAAGACGAGACTGCGTACTGCTCTCAATAAACTCCCTGACAT CGATGAGGTCCACGAGAAGACGCAACTAGACATCCCTGAACCCTATAGAGTCTACAGACTGCTGCCCAAAAAACCATCCAACAGCG CAATGAAAAACCGGCTTCCGACCAGCCCAACGT 3'

Discussion and Conclusion

Echinoderms occupy a critical and largely unexplored phylogenetic situation from the point of view of the evolution and of studies of the sea star immune system. Scepticism occured as for the existence of the primitive sea star antibody [8]. To day it seems obvious that the discovery of IRF4 in immunized sea stars, of IRF2 and IRF8 in both immunized and non-immunized sea stars to HRP corroborate the presence of such an invertebrate primitive antibody in Asterias rubens: an Igkappa primitive antibody. In conclusion, these IRF genes control the regulation of this last one.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

  • 12th Annual Conference on Stem Cell and Regenerative Medicine June 04-06, 2018 Prague, Czech Republic
    June 04-06, 2018 Prague, Czech Republic
  • 4th International Conference on Bioscience July 2-3, 2018 Vienna, Austria
    July 2-3, 2018 Vienna, Austria
  • 22nd World Congress on Biotechnology July 10-11, 2018 Bangkok, Thailand
    April 16-18, 2018 Amsterdam, Netherlands
  • 9th International Conference on Tissue Science and Regenerative Medicine July 13-14, 2018 Sydney, Australia
    April 23-24, 2018 Las Vegas, USA
  • 10th Annual Conference on Stem Cell and Regenerative Medicine August 13-14, 2018 London, UK
    August 13-14, 2018 London, UK
  • World Congress on Stem Cell Biology and Biobanking September 3-4, 2018 Tokyo, Japan
    September 3-4, 2018 Tokyo, Japan
  • 2nd Annual summit on Cell Metabolism and Cytopathology September 19 - 20, 2018 Philadelphia, Pennsylvania, USA
    September 19 - 20, 2018 Philadelphia, USA
  • 2nd Annual summit on Cell Signaling and Cancer Therapy September 19 - 20, 2018 Philadelphia, Pennsylvania, USA
    September 19 - 20, 2018 Philadelphia, USA
  • 6th Annual Congress on Biology and Medicine of Molecules September 20-21,2018 Kuala Lumpur, Malaysia
    September 20-21,2018 Kualalumpur, Malaysia
  • 5th International Conference on Human Genetics and Genetic Disorders September 21-22,2018 Philadelphia, Pennsylvania, USA
    September 21-22,2018 Philadelphia, USA
  • 11th International Conference on Genomics and Pharmacogenomics September 21-22, 2018 Philadelphia, Pennsylvania, USA
    September 21-22, 2018 Philadelphia, USA
  • 5th World Congress on HUMAN GENETICS SEPTEMBER 24-25, 2018 BERLIN, GERMANY
    SEPTEMBER 24-25, 2018 Berlin, Germany
  • 21st Euro Biotechnology Congress October 11-12, 2018 Moscow, Russia
    October 11-12, 2018 Moscow, Russia
  • 11th International Conference on Tissue Engineering & Regenerative Medicine October 18-20, 2018 Rome, Italy
    October 18-20, 2018 Rome, Italy
  • 24th Biotechnology Congress: Research & Innovations October 24-25, 2018 Boston, USA
    October 24-25, 2018 Boston, USA
  • International Conference on Human Genome Meeting October 25-26, 2018 Istanbul, Turkey
    October 25-26, 2018 Istanbul, Turkey
  • International Congress & Expo on Genomics and Bioinformatics November 2-3, 2018 Columbus, Ohio, USA
    November 2-3, 2018 Columbus, USA
  • 12th International Conference & Exhibition on Tissue Preservation and Biobanking November 9-10, 2018 Atlanta, Georgia, USA
    November 9-10, 2018 Atlanta, USA
  • 2nd Annual Summit on Cell Therapy and Stem Cell Research November 9-10, 2018 Atlanta, Georgia, USA
    November 9-10, 2018 Atlanta, USA

Article Usage

  • Total views: 8233
  • [From(publication date):
    June-2016 - May 28, 2018]
  • Breakdown by view type
  • HTML page views : 8148
  • PDF downloads : 85

Review summary

  1. Shanawaz
    Posted on Aug 23 2016 at 5:33 pm
    research article studied specific genes in sea star playing the role in adaptive immunity. The article provides useful information and will help in the improving the treatment practices in persons with special needs.
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7