alexa First Record of Ixodes affinis Tick (Acari: Ixodidae) Infected with Borrelia burgdorferi Sensu Lato Collected from a Migratory Songbird in Canada | Open Access Journals
ISSN: 2155-9597
Journal of Bacteriology & Parasitology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

First Record of Ixodes affinis Tick (Acari: Ixodidae) Infected with Borrelia burgdorferi Sensu Lato Collected from a Migratory Songbird in Canada

John D Scott1*, Kerry L Clark2, Janet E Foley3, Lance A Durden4, Jodi M Manord2 and Morgan L Smith2

1Research Division, Lyme Ontario, 365 St. David Street South, Fergus, Ontario, Canada

2Epidemiology & Environmental Health, Department of Public Health, University of North Florida, Jacksonville, Florida 32224, USA

3Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, Davis, California 95616, USA

4Department of Biology, Georgia Southern University, 4324 Old Register Road, Statesboro, Georgia 30458, USA

*Corresponding Author:
John D. Scott
Research Division, Lyme Ontario
365 St. David Street South, Fergus, Ontario N1M 2L7, Canada
Tel: 519-843-3646
Fax: +1-650-618-1414
E-mail: [email protected]

Received Date: April 14, 2016; Accepted Date: June 25, 2016; Published Date: June 30, 2016

Citation: Scott JD, Clark KL, Foley JE, Durden LA, Manord JM, et al. (2016) First Record of Ixodes affinis Tick (Acari: Ixodidae) Infected with Borrelia burgdorferi Sensu Lato Collected from a Migratory Songbird in Canada. J Bacteriol Parasitol 7:281. doi: 10.4172/2155-9597.1000281

Copyright: © 2016 Scott JD, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Bacteriology & Parasitology

Abstract

Migratory songbirds transport hard-bodied ticks (Acari: Ixodidae) into Canada during northward spring migration, and some of these bird-feeding ticks harbor a wide diversity of pathogenic microorganisms. In this study, we collected a nymphal Ixodes affinis Neumann from a Common Yellowthroat, Geothylypis trichas (Linnaeus), at Ste-Anne-de-Bellevue, Québec, and it was infected with the Lyme disease bacterium, Borrelia burgdorferi sensu lato (s.l.) Johnson, Schmid, Hyde, Steigerwalt & Brenner. Using PCR on this tick extract and DNA sequencing on the borrelial amplicons, we detected B. burgdorferi sensu stricto (s.s.), a genospecies that is pathogenic to people and certain domestic animals. In addition, we collected an I. affinis nymph from a Swainson's Thrush, Catharus ustulatus (Nuttall), at Toronto, Ontario, and a co-feeding nymphal blacklegged tick, Ixodes scapularis Say, tested positive for B. burgdorferi s.s. These bird-tick findings constitute the first reports of I. affinis in Ontario and Québec and, simultaneously, the first report of a B. burgdorferi s.l.-infected I. affinis in Canada. Since Neotropical and southern temperate songbirds have a rapid flight pace, they are capable of transporting ticks infected with B. burgdorferi s.l. hundreds of kilometres to Canada. Healthcare professionals should be cognisant that migratory songbirds can transport diverse genotypes of B. burgdorferi s.l. into Canada from southern latitudes that may be missed by current Lyme disease serological tests.

Keywords

Tick; Ixodes affinis ; Borrelia burgdorferi; Lyme disease; Migratory songbirds; Bird parasitism; Eastern Canada

Abbreviations:

PCR: Polymerase Chain Reaction

Introduction

Ixodes affinis Neumann (Acari: Ixodida: Ixodidae) is an obligate, blood-sucking ectoparasite that feeds on mammals and birds [1,2]. Biogeographically, this ixodid (hard-bodied) tick is native to Central and South America [3], and occurs in the United States from Florida to Virginia [2,4,5]. In the coastal plains of the Mid-Atlantic and southeastern United States, I. affinis parasitizes a wide array of mammals, including cotton mouse, Peromyscus gossypinus (LeConte); cotton rat, Sigmodon hispidus Say and Ord; marsh rice rat, Oryzmys palustris Harlan; southern short-tailed shrew, Blarina carolinensis (Bachman); gray squirrel, Sciurus carolinensis Gmelin; eastern cottontail, Sylvilagus floridanus (J.A. Allen); raccoon, Procyon lotor (Linnaeus); Virginia opossum , Didelphis virginiana (Kerr); domestic cat, Felis catus (L.); dog, Canis lupus familiaris L.; bobcat, Lynx rufus (Schreber); cougar, Puma concolor (L.); white-tailed deer, Odocoileus virginianus Zimmermann; and American black bear, Ursus americanus (Pallus) [2]. In particular, the cotton mouse and the cotton rat are major reservoir hosts for Borrelia burgdorferi sensu lato (s.l.) Johnson, Schmid, Hyde, Steigerwalt & Brenner in the southeastern United States [6]. Of biological and medical significance, I. affinis enhances the epidemiological cycle of B. burgdorferi s.l., especially within indigenous areas [7].

Songbirds (Passeriformes) are avian hosts of I. affinis and I. scapularis larvae and nymphs [1,5,8]. While en route to their breeding grounds, passerine migrants make landfall at Lyme disease endemic areas, and are often parasitized by host-seeking ticks. Since peak questing activity of I. scapularis and I. affinis nymphs coincides with peak northward songbird migration, ground-frequenting passerines are often parasitized by both of these nymphal species. In Canada, Scott et al. [8] reported I. affinis and I. scapularis on a Swainson's Thrush, Catharus ustulatus (Nuttall), in south-central Manitoba during northward spring migration. In a recent study, Heller et al. [5] reported I. affinis immatures on 6 different passerine species in southeastern Virginia, and one songbird-derived nymph was infected with B. burgdorferi s.l.

Based on tick-host-pathogen studies in the southeastern United States, researchers found that I. affinis is a competent vector of the Lyme disease bacterium, B. burgdorferi s.l. [6,7]. Globally, the B. burgdorferi s.l. complex consists of at least 23 genospecies or genomospecies. In North America, at least nine B. burgdorferi s.l. genospecies are present, namely B. americana , B. andersonii , B. bissettii , B. burgdorferi sensu stricto (s.s.), B. californiensis, B. carolinensis , B. garinii , B. kurtenbachii , and B. mayonii [9-16]. Of these genospecies, B. americana , B. andersonii , B. bissettii , B. burgdorferi s.s., B. garinii , and B. mayonii are known to be pathogenic to humans [16-20].

The aim of the present study was to expound on the movement of songbird-transported ticks in the Northern Hemisphere during northward spring migration, and report any novel tick-host associations in Canada. In addition, we wanted to determine whether any ticks on Neotropical and southern temperate songbirds are infected with B. burgdorferi s.l.

Materials and Methods

Tick collection

During spring migration, I. affinis and I. scapularis nymphs were collected from songbirds by bird banders at four different sites in eastern Canada. Nymphs were removed using fine-pointed, stainless steel forceps, and stored in polypropylene vials that were labelled with background information (i.e., bird species, collection date, geographic location, collector's name). The vented vials were placed in a selfsealing, double-zippered plastic bag with slightly moistened paper towel. The ticks were promptly sent by express mail to the tick identification laboratory (J.D.S.). The nymphal ticks were tentatively identified using a taxonomic key [21]. After fully engorged nymphs moulted to adults, they were put in 94% ethyl alcohol, and sent by overnight courier for confirmation of identification (L.A.D.).

Spirochete detection

In phase 1, ticks were sent to a separate laboratory (K.L.C.) for B. burgdorferi s.l. testing and molecular analysis. DNA extraction, PCR testing, and DNA sequencing were performed as previously described [22].

In phase 2, four I. affinis nymphs, which were collected in 2016, were sent to another laboratory (J.E.F) for PCR testing and molecular analysis. The flagellin gene was used on these I. affinis ticks. The primers include:

External :
FlaLL: ACATATTCAGATGCAGACAGAGGT;
FlaRL: GCAATCATAGCCATTGCAGATTGT;

Internal:
FlaLS: AACAGCTGAAGAGCTTGGAATG;
FlaRS: CTTTGATCACTTATCATTCTAATAGC.

The methodology for DNA extraction, PCR testing, and DNA sequencing is outlined in the scientific articles [23-26].

Nucleotide sequence accession numbers

The DNA sequence of the 194-bp (base position 313 to 506), and the 206-bp (base position 532 to 737) amplicons of B. burgdorferi s.l. flagellin (flaB) gene, which were acquired from the I. affinis nymph (15-5A51) using PCR1 and PCR2 primer sets have been deposited in the GenBank data base with accession number: KX011447. In addition, B. burgdorferi s.l. amplicons from the I. scapularis nymph (15-5A47A) using PCR1 and PCR2 primer sets have been submitted to the GenBank database with accession number: KX011446.

Results

Six Ixodes nymphs were collected from five species of passerine birds at four different collection sites in eastern Canada (Figure 1). The vector-host-pathogen associations are listed in Table 1. A partially engorged I. scapularis nymph (15-5A47A) and a fully engorged I. affinis nymph (15-5A47B) were collected from a Swainson's Thrush on 24 May 2015 at Toronto, Ontario. The I. scapularis nymph moulted to a female in 39 d, whereas the I. affinis nymph moulted to a female in 43 d. The I. scapularis nymph tested positive for B. burgdorferi s.l., and the I. affinis was negative. This bird parasitism is the first record of I. affinis in Ontario and, simultaneously, the first documentation of I. affinis on a bird in this province.

bacteriology-parasitology-Geographic-locations

Figure 1: Geographic locations in eastern Canada where ticks (I. affinis , I. scapularis ) were collected from migratory songbirds: 1. McGill Bird Observatory, Ste-Anne-de-Bellevue, Québec, 45.43°N, 73.94°W; 2. Tommy Thompson Park Bird Research Station, Toronto, Ontario, 43.63°N, 79.33°W; 3. Long Point Bird Observatory, Tip of Long Point, Ontario, Canada, 42.55°N, 80.05°W; and 4. Ruthven Park National Historic Site Banding Station, Haldimand Bird Observatory, Cayuga (York), Ontario, 42.97°N, 79.87°W. Parenthesis indicates mailing address.

bacteriology-parasitology-passerine-birds

Table 1: Detection of B. burgdorferi s.l. in Ixodes affinis collected from passerine birds in eastern Canada, by province, 2015-2016.

Table 1: Detection of B. burgdorferi s.l. in Ixodes affinis collected from passerine birds in eastern Canada, by province, 2015-2016.

At Ste-Anne-de-Belleville, Québec, a partially engorged I. affinis nymph (15-5A51) was collected from a Common Yellowthroat, Geothylypis trichas (Linnaeus), a southern temperate songbird, on 26 May 2015 (Figure 2). The nymph tested positive for B. burgdorferi s.l. and, based on DNA sequencing, was validated as B. burgdorferi s.s. The discovery of I. affinis nymphs in Québec constitutes a new extralimital distribution record for this tick species. As well, it is the first account of I. affinis on birds in Québec and, notably, the first report of a B. burgdorferi s.l.-infected I. affinis in Canada.

bacteriology-parasitology-Common-Yellowthroat

Figure 2: Common Yellowthroat, male, parasitized by a partially engorged Ixodes sp. nymph. Arrow points to engorged nymph. Photo credit: late Bronwyn Dalziel.

Upon DNA sequencing and molecular analysis, the three B. burgdorferi s.l. amplicons were determined to be B. burgdorferi s.s., a genospecies pathogenic to humans and certain domestic animals.

Discussion

We document the first records of I. affinis in eastern Canada, and the first B. burgdorferi s.l.-infected I. affinis in Canada. Our vectorhost- pathogen findings show that Neotropical and southern temperate songbirds transport I. affinis into Canada during northern spring migration from indigenous areas in Central and South America and the southern United States. Not only are migratory songbirds transporting ixodid ticks into Canada, they are importing B. burgdorferi s.l.-infected ticks.

Ixodes affinis transported to Canada

In this study, a Common Yellowthroat, a southern temperate songbird, transported a B. burgdorferi s.s.-infected I. affinis nymph to Ste-Anne-de-Bellevue, Québec. At repletion, this fully engorged nymph could have moulted to a female in the wild and, subsequently, could have attached to a dog or cat or another suitable wild mammal, and transmitted Lyme disease spirochetes to the host. In a separate bird-tick association, a Swainson's Thrush was parasitized by an I. affinis nymph that was co-feeding with the B. burgdorferi s.s.-infected I. scapularis nymph. If the Swainson's Thrush became spirochetemic during co-infestation, the I. affinis nymph could also have become infected with B. burgdorferi s.s. by the time of repletion. During the co-feeding process, the I. scapularis and the I. affinis nymphs imbibe, regurgitate, and share the host's blood and, thus, the I. affinis nymph could have subsequently acquired Lyme disease spirochetes. After the I. scapularis nymph and the I. affinis nymph dropped from the Swainson's Thrush, they would have instinctively descended into the cool, moist leaf litter, and later moulted to adults and, ultimately, parasitized vertebrate hosts, including humans.

Anderson and Magnarelli [27] cultured B. burgdorferi s.l. from a Common Yellowthroat, and revealed that this bird species is a reservoir-competent host. As well, tick researchers have collected B. burgdorferi s.l.-infected I. scapularis larvae from Common Yellowthroat which reinforces host competency of this bird species [27-29]. Since transovarial transmission of B. burgdorferi s.l. does not typically occur in I. scapularis [30], this tick species must acquire B. burgdorferi s.l. during a blood meal. Either the I. affinis nymph acquired B. burgdorferi s.s. directly from the Common Yellowthroat or, as a larva, acquired the infection while feeding on a spirochetemic host.

Importation of B. burgdorferi s.l. into Canada

Migratory songbirds are a natural mode of transporting B. burgdorferi s.l.-infected ticks into Canada. In this study, passerine migrants transported B. burgdorferi s.s.-infected I. affinis and I. scapularis immatures into eastern Canada. Not only have B. bissettii and B. burgdorferi s.s. been isolated from both of these Ixodes species in the southeastern United States, B. carolinensis was detected in a Carolina Wren, Thryothorus ludovicianus Veillot [31], in the same region. Consequently, it would certainly be plausible for a passerine migrant to transport I. affinis immatures into Canada infected with B. bissettii , B. burgdorferi s.s., and B. carolinensis .

In Canada, Banerjee et al. [32] cultured B. burgdorferi s.l. (isolate BC93T1340) from Ixodes angustus Neumann detached from a wild deer mouse, Peromyscus maniculatus Gloger, collected at Squamish, British Columbia; this novel borrelial isolate was later delineated as B. bissettii (GenBank no. AY077830). Rudenko et al. [19] provided the first successful cultivation of live B. bissettii from a North American patient, and the first recovery of B. burgdorferi s.s. from residents in the southeastern United States. Notably, these symptomatic patients were seronegative for Lyme disease, and had undergone antibiotic treatment based on the suspicion of having Lyme disease. These findings could likewise explain why some Canadian patients are seronegative for Lyme disease. Biomedical researchers have found that B. bissettii can be missed by current Lyme disease serology and, because of this fact, members of the health-care profession have not recognized the presence of B. bissettii in patients in Canada. Commercial serological tests, which are based on immune response, yield unsatisfactory results for Lyme disease screening [33], especially in the advanced disease stage, and have a sensitivity of only 46-53% in patients who have gone beyond the early disseminated stage [34]. Our study underpins the fact that passerine migrants are transporting I. affinis ticks into Canada from southern latitudes that are infected with B. burgdorferi s.s. and, potentially, harbor B. bissettii and B. carolinensis that may be missed by current serological testing.

B. burgdorferi s.l. in patients associated with I. affinis

The isolation of motile B. bissettii -like strains from patients provides evidence that diverse Borrelia, other than B. burgdorferi s.s., could cause Lyme disease in humans across North America. Globally, B. bissettii has been isolated from patients in California and Europe [17,35,36] and, recently, obtained from local residents in the southeastern United States [20]. Because B. bissettii -like strains are present in rodents, birds, and Ixodes ticks (i.e., I. affinis , I. minor ) in the southeastern United States, their presence signals the fact that this B. burgdorferi s.l. genospecies is circulating in a zoonotic disease cycle between wildlife hosts and people [7].

Since I. affinis and I. minor are transported into Canada by southern temperate and Neotropical songbirds during spring migration [8,37], Canadians will likely be subject to Lyme disease-causing B. bissettii , B. burgdorferi s.s., and B. carolinensis from the southeastern United States and, potentially, from Central and South America.

Epidemiological cycle of B. burgdorferi s.l. in Canada

In the southeastern United States, I. affinis plays a key role in perpetuating the epidemiological cycle of B. burgdorferi s.l. in wildlife, and I. scapularis acts as a bridge vector to humans [6,7]. Such avian and mammalian parasitisms could also occur in central and eastern Canada with suitable hosts. An analogous example is seen in farwestern Canada where Ixodes spinipalpis Hadwen & Nuttall is an enzootic vector of B. burgdorferi s.l., and Ixodes pacificus Cooley and Kohls acts as a bridge vector to humans [38]. When I. pacificus ticks feed on reservoir hosts, they may subsequently bite and transmit Lyme disease spirochetes to humans and other vertebrates. When I. affinis immatures are transported into Canada by passerine migrants, they encounter several new hosts; however, there are still many vertebrate species that are the same as those inhabiting southeastern U.S.A. Some of these similar mammalian hosts include: raccoons, Virginia opossum, white-tailed deer, American black bear, plus cats and dogs. In essence, I. affinis can potentially transmit B. burgdorferi s.l. to several reservoir hosts in Canada. Whenever any of these B. burgdorferi s.l.-infected hosts are bitten by I. scapularis immatures, they can subsequently transmit Lyme spirochetes to humans. Since migratory songbirds widely disperse Lyme vector ticks, people do not have to visit an endemic area to contract Lyme disease.

Flight pace of migratory songbirds

Many Neotropical and southern temperate songbirds have an extraordinary capability to fly long distances in a short period of time. Ogden et al. [39] conjectured that the maximum distance that songbirds can travel during a 5-day engorgement period is 425 km. However, the present study shows that the fully engorged B. burgdorferi s.s.-infected I. affinis nymph, which detached from the Common Yellowthroat at Ste-Anne-de-Bellevue, Québec, was transported much further than 425 km from its home range in the southeastern United States (Portsmouth, Virginia to Miami, Florida); the flight distance is estimated to be 670 km to 1700 km. Similarly, Scott et al. [8] reported four I. affinis immatures (1 nymph, 3 larvae) on a Swainson's Thrush, which is a Neotropical migrant, collected in south-central Manitoba; the estimated flight distance from the home range of these I. affinis specimens was approximately 1720 km (Charleston, South Carolina to Delta Marsh, Manitoba). Since the Swainson's Thrush also has a winter range from southern Mexico to South America, this passerine may have also transported I. affinis nymphs several thousand kilometres from the Neotropics. Stutchbury et al. [40] used light-sensitive geolocators (nano-tags) to follow the daily flight of Neotropical songbirds, and discovered that certain passerine migrants have a flight pace of 750 km/d, or more, during northward spring migration. In addition, DeLuca et al. [41] tracked Blackpoll Warblers, Setophaga striata (Forster), during fall migration, and discovered they flew an average distance of 2540 km (923 km/d) during a 62-h, non-stop flight over the Atlantic Ocean. Clearly, some passerine migrants, such as the Common Yellowthroat and Swainson's Thrush, have the capacity to fly long distances much greater than 425 km during a 5-day engorgement period. The presence of Neotropical Amblyomma and Ixodes ticks on passerine migrants in Canada during spring migration provides irrefutable evidence that birds transport ticks thousands of kilometres, and disperse them widely across southern Canada [8,29,37,42-49]. When certain passerine migrants have warm temperatures, high energy diets, and southern winds, they can fly to Canada more than 10 times the distance that some researchers claim.

Recognition of I. affinis in northern latitudes

Even though I. affinis is not indigenous in Canada, this birdtransported tick is able to initiate B. burgdorferi s.l. infections in Canada. After the moult, this tick species can infect suitable hosts, and start a Lyme disease focus. Not only have I. affinis immatures been transported to Canada, other Ixodes species (i.e., I. minor) have been transported great distances from more southern latitudes [37]. Because I. affinis is morphologically similar to I. scapularis , it is likely that I. affinis has been misidentified as I. scapularis , especially in northern latitudes. Since I. affinis is not indigenous to Canada, the presence of larval and nymphal I. affinis on Neotropical and southern temperate songbirds during northbound spring migration provides confirmatory evidence that avifauna are importing I. affinis into Canada.

Gene mixing and diversity of Lyme disease symptoms

As an enzootic vector, I. affinis can directly transmit heterogeneous variants of B. burgdorferi s.l. to dogs, cats, and certain wildlife animals. Since I. affinis is transported by migratory songbirds, various strains of B. burgdorferi s.l. can occur within an avian host and, subsequently, be transmitted to songbird-transported ticks to northern latitudes. Rudenko et al. [31] detected B. carolinensis in a Carolina Wren and, likewise, in a bird-feeding I. minor . Of note, Scott and Durden [37] discovered an I. minor on a Common Yellowthroat in Canada during spring migration. Furthermore, Scott et al. [8] collected B. burgdorferi s.l.-positive I. dentatus larvae in Canada that were collected from a Swainson's Thrush during northward spring migration. In North America, larval and nymphal I. scapularis have been collected from at least 78 bird species [45], and I. scapularis is known to harbor B. burgdorferi s.s. and B. bissettii [6]. Any combination of four passerinetransported Ixodes species (i.e., I. affinis , I. dentatus , I. minor , I. scapularis ), which are all enzootic vectors, could be directly involved in borrelial gene mixing of B. burgdorferi s.l. during a long-distance migratory host flight.

The presence of 2 or more ticks, which are infected with different B. burgdorferi s.l. genotypes on a passerine proliferates a platform for gene mixing and microbial diversity. In particular, Scott and Durden [50] reported several B. burgdorferi s.l. genotypes in songbird-derived ticks collected in the Long Point bioregion. Such borrelial variants can be missed by current Lyme disease serology. In fact, Rudenko et al. [19] isolated B. burgdorferi s.s. and B. bissettii -like spirochetes from symptomatic patients, which were previously treated with antibiotics, but were seronegative for Lyme disease. The isolation of a live B. bissettii -like strain from a patient provides substantive evidence that this Borrelia genotype, and other Borrelia genospecies causes Lyme disease in North America [19]. Based on previous serological screening worldwide, it stands to reason that gene mixing of B. burgdorferi s.l. could ultimately result in inaccurate or false negative Lyme disease serology [19,33]. On the clinical front, gene mixing in songbirdtransported ticks and their avian hosts could also explain the variation of Lyme disease symptomology in dogs, cats, and humans [18].

Zoonotic and human implications

The importation of I. affinis on migratory songbirds reveals a unique interconnecting link between B. burgdorferi s.l., people, birds, ticks, domestic and wildlife hosts. B. burgdorferi s.s. causes a myriad of clinical manifestations in people of all ages, including profound fatigue, memory loss, inflammation, spinal or radicular pain, poor balance, sleep disturbance, head pressure, and cognitive impairment, especially in the advanced stage [51-53]. Chronic neurological Lyme disease patients often encounter tingling, numbness, burning sensations of the extremities [53]. B. burgdorferi s.l. lipoproteins, namely outer surface proteins and flagellin, are inducers of inflammatory cytokines. In vivo, B. burgdorferi s.l. has several pleomorphic forms (i.e., spirochetes, blebs, granules, round bodies) [54] and, collectively, these aggregates form gelatinous biofilm colonies [55,56]. Since B. burgdorferi s.l. has diverse forms, it may be recalcitrant to treatment, especially in the advanced tertiary stage. If left untreated or inadequately treated, B. burgdorferi s.l. can persist in deep-seated tissues, including bone [57,58], brain [59-61], eye [62], glial and neuronal cells [63,64], ligaments and tendons [65,66], muscles [67], and fibroblasts/scar tissue [68]. Because B. burgdorferi s.l. can outwit the immune system by evading the innate and adaptive immune responses of the body, it can hide in immune privileged sites [69]. Several researchers have documented persistence of B. burgdorferi s.l. in numerous mammalian hosts, including humans [18,70-73]. In addition, Lyme disease spirochetes spread to the central nervous system, and can persist in the body for years [74-77]. Pain can be so debilitating that some patients lose their ability to function in a meaningful and productive way. Often, patients are confined to their residence, and end up on disability, and are unable to work or attend school. As B. burgdorferi s.l. advances and prevails in tissues and organs, this spirochetosis can result in fatal outcomes [59,76]. Whenever B. burgdorferi s.s. and B. bissettii are isolated from seronegative patients, these cultures provide irrefutable evidence that these genospecies do, in fact, cause Lyme disease. Moreover, even though infected rhesus macaques had been treated with antibiotics, Embers et al. [70] have documented B. burgdorferi s.l. in these seronegative primates, and conclusively determined that Lyme disease can be persistent.

In conclusion, we provide compelling proof that migratory songbirds transport I. affinis into Canada during northward spring migration. We document the first record of a B. burgdorferi s.s.- positive I. affinis in Canada and, synchronously, provide new host and distribution records for this tick species. Furthermore, we provide new evidence that I. affinis can be added to the list of competent enzootic vectors of B. burgdorferi s.l. in Canada. After I. affinis immatures are dispersed in Canada, they can moult during the summer and, if infected, transmit Lyme disease spirochetes to suitable vertebrate hosts. Additionally, I. scapularis immatures can act as a bridge vector to people and certain domestic animals. It is an inescapable fact that migratory songbirds are transporting ticks into Canada during northward spring migration, and some of these engorged ticks are infected with B. burgdorferi s.s., which is pathogenic to humans and certain domestic animals. Ultimately, it is firmly established that people do not have to frequent an endemic area to contract Lyme disease. Medical professionals, veterinarians, biomedical scientists, and public health officials should be vigilant that diverse variants of B. burgdorferi s.l. are introduced by songbird-transported Ixodes ticks, and pose a country-wide public health risk.

Acknowledgments

We thank Simon Duval, Charlotte England, and Nigel Shaw for collecting ticks from migratory songbirds. We are indebted to Kenny Lou for technical assistance. We pay special tribute to the late Bronwyn Dalziel for her outstanding ornithology work. We are grateful to John Ward for computer graphics. Funding support was provided in part by Lyme Ontario.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 8289
  • [From(publication date):
    June-2016 - Jun 28, 2017]
  • Breakdown by view type
  • HTML page views : 8191
  • PDF downloads :98
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords