alexa Genetic Analysis of Ten Gonosomal STR Loci in an Italian Population Using the Elucigene QSTR-XY Amplification Kit | Open Access Journals
ISSN: 2157-7145
Journal of Forensic Research
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Genetic Analysis of Ten Gonosomal STR Loci in an Italian Population Using the Elucigene QSTR-XY Amplification Kit

Enrica Ottaviani1,2, Cristina Peconia1, Ilenia Pietrangelia1, Tonino Luigi Marsella3, Giovanni Arcudi3, Giuseppe Novelli1,4 and Emiliano Giardina1,5*

1Department of Biomedicine and Prevention, Laboratory of Forensic Genetics, University of Rome Tor Vergata, via Montpellier, 00133 Rome, Italy

2Direzione Centrale Anticrimine della Polizia di Stato, Servizio di Polizia Scientifica,via Tuscolana 1548, 00173 Rome, Italy

3Department of Experimental Medicine and Surgery-Institute of Legal Medicine, Faculty of Medicine, University of Rome Tor Vergata, via Montpellier , 00133 Rome, Italy

4S. Pietro Fatebenefratelli Hospital, via Cassia 600, 00189 Rome, Italy

5Laboratory of Molecular Genetics UILDM, Fondazione Santa Lucia, Rome, Italy

*Corresponding Author:
Emiliano Giardinaa
Laboratory of Molecular Genetics UILDM
Fondazione Santa Lucia, Rome, Italy
Tel: +39 06 72596030
Fax: +39 0699266531
E-mail: [email protected]

Received Date: February 03, 2014 Accepted Date: August 18, 2015 Published Date: August 24, 2015

Citation: Ottaviani E, Peconia C, Pietrangelia I, Marsella TL, Arcudi G, et al. (2015) Genetic Analysis of Ten Gonosomal STR Loci in an Italian Population Using the Elucigene QST*R-XY Amplification Kit . J Forensic Res 6:298. doi:10.4172/2157-7145.1000298

Copyright: © 2015 Ottaviani E, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Forensic Research

Abstract

Genotyping of X-chromosomal short tandem repeats (X-STRs) is an emerging tool in forensic genetics because of its inheritance pattern, and a large number of markers has been characterized. Quantitative fluorescence polymerase chain reaction (QF-PCR) analyses of STR markers on the X-chromosome are performed routinely in medical genetics laboratories for the rapid detection of aneuploidy in chromosome X. In this study, 595 Italian participants were genotyped at 10 gonosomal STRs (DXS680, DXS98, DXS6807, DXS1187, XHPRT, DXS742, DXS6809, DXYS267, DXYS218, and DYS448) using a commercially available QF-PCR kit. Here, we report the allele architecture of DXS1187 and DXYS218, which have not previously been characterized for forensic use. The presence and extent of genetic linkage and linkage disequilibrium between all X-STRs were estimated. Allele and haplotype frequencies in the Italian population were assessed and reported together with statistical parameters.

Keywords

Allele frequencies; Haplotype frequencies; Elucigene QST*R-XY; X-STR markers; DXS1187; DXYS218

Abbreviations

STR: Short Tandem Repeat; PIC: Polymorphism Information Content; PD: Power of Discrimination; MEC: Mean Exclusion Chance

Introduction

Analyses of X-chromosome markers are useful supplemental tools for genetic investigation, kinship analysis, deficiency paternity cases, and for interpretation of complex profiles in DNA mixtures. Several X-chromosomal markers have been characterized by the forensic DNA community, and assays have been developed to detect of X-chromosomal short tandem repeats (X-STRs) [1]. Commercial kits that analyze STR markers for medical purposes also have emerged. Quantitative fluorescence polymerase chain reaction (QF-PCR) is a routine technique in prenatal genetic diagnosis that allows for rapid, simple, and inexpensive diagnoses of common aneuploidies [2]. Similarly to current forensic DNA kits, highly polymorphic STRs are amplified readily using fluorescent dye-labelled primers, detected with capillary electrophoresis, and analyzed using GeneMapper software [3]. QF-PCR results are interpreted according to the number and the fluorescence intensity of alleles at each locus. The methods and chemistry of QF-PCR diagnostic kits are similar to those currently used in forensic DNA analyses, but these kits have not been evaluated formally by the forensic DNA community. We examined the Elucigene QST*R-XY kit (Gen-Probe Life Sciences Ltd, Abingdon, UK), a DNA-based multiplexed assay for the rapid prenatal determination of sex chromosomal aneuploidies, including Klinefelter and Turner syndromes. This 12-plex QF-PCR enables the identification of the Amelogenin marker, which amplifies non-polymorphic sequences on the X (104 bp) and Y (110 bp) chromosomes, and of the non-polymorphic Y-specific SRY marker, which permits gender determination. Elucigene QST*R-XY targets (1) the pseudoautosomic STR markers, DXYS267 and DXYS218, located in both the X and Y chromosomes; (2) the X-specific markers, DXS680, DXS98, DXS6807, DXS1187, XHPRT, DXS742, and DXS6809; and (3) the Y-specific marker, DYS448 [4].

In this study, we describe the allele frequencies of these gonosomal STR markers in an Italian population, and we characterize the STR structures of the novel markers, DXS1187 and DXYS218. Statistical and genetic parameters confirm the informativity and usefulness of the Elucigene QST*R-XY for forensic purposes.

Materials and Methods

Samples and data collection

DNA was extracted from buccal swabs of 595 unrelated healthy volunteer donors born in the Central Italy (284 males, 311 females) using a QIAamp DNA Blood mini kit (Qiagen, Hilden, Germany). All individuals provided their written informed consent.

All DNA samples were amplified using Elucigene QST*R-XY kits (Gen-Probe Life Sciences Ltd, Abingdon, UK) by dispensing 2 μl of DNA into a 0.2-ml PCR vial containing 10 μl QST*R-XY reaction mix. Samples were amplified on an Applied Biosystems 9800 Fast Thermal Cycler according to the following program: initial denaturation at 95°C for 15 min, 26 cycles of 95°C for 30 s, 59°C for 90 s, and 72°C for 90 s, final extension at 72°C for 30 min. PCR products were separated and detected on an ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA). Raw data were analyzed using GeneMapper ID 3.2 software (Applied Biosystems), according to the manufacturer’s recommendations.

Analysis of STR structures

To establish a correspondence between electrophoretic lengths (bp) and allele structures, we sequenced the STRs of several homozygote/hemizygote samples. Elucigene QST*R-XY enables the detection of 10 STRs, of which 8 have been described previously for forensic purposes [5-14]. We extensively sequenced and characterized the structures of the novel markers, DXS1187 and DXYS218. Forward and reverse primers (Invitrogen) were designed and used for PCR and sequencing (Table 1). PCR was performed in 25 µl reaction volumes each containing 5-10 ng of genomic DNA, 0.7 µM of each primer, 200 µM of each dNTP, 2 mM MgCl, 1 U of AmpliGold Taq DNA polymerase (Applied Biosystems), and 10X PCR buffer (Applied Biosystems) using a GeneAmp® PCR System 9700 (Applied Biosystems). 0 Samples were amplified according to the following program: initial denaturation at 96°C for 10 min, 30 amplification cycles at 96°C for 1 min, 57-60°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 30 min. Following enzymatic purification with 1 U exonuclease I and 2 U alkaline phosphatase (Ambion, Austin, TX), samples were sequenced using a BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems) according to the manufacturer’s instructions. Sequencing reaction products were purified from the residual dye terminators using a BigDye XTerminator Purification kit (Applied Biosystems). Repeat structures were determined by direct sequencing of PCR products using an ABI 3130xl Genetic Analyzer (Applied Biosystems).

Marker Primer sequence (5’-3’)
DXS6807 F: 5’AAAATACTCCCACCCCCAGT 3’
R:5’TGCATGCATGTTCACATAACTT 3’
DXS981 F: 5’ CGATGAAAGAGTTGGAGATTGTG 3’
R: 5’ CACCATATTGTTCCTTGAGTCCT 3’
DXS6803 F:5’TGTGCTTTGACAGGAAAAACAA 3’
R: 5’ TTCACTTGCTATGTGAAAGAAGC 3’
DXS6809 F: 5’ TGCTTTAGGCTGATGTGAGG 3’
R: 5’ CAGGAATACTGAGGGCATGA 3’
XHPRT F: 5’ AGAGGGCAGTAGCTTTCAGCTT 3’
R: 5’ TGCCACAGATAATACACATCCCC 3’
DXS7423 F: 5’ TGCGAGCCCACTCTTTCTAT 3’
R: 5’ TGGCCTTTGTCTCCAGTACC 3’
DXS1187 F: 5’ AGGCACCTTTCAGCTACTCA 3’
R: 5’ AGAGGGTGATATGGGGGACT 3’
DXYS267 F: 5’ GTGGTCTTCTACTTGTGTCAATAC 3’
R:5’ GTGTGTGGAAGTGAAGGATAG 3’
DXYS218 F: 5’ CTTCTCCCAAGCTGGGTTCT 3’
R: 5’ CAACTGAGGGGACCTGGAAT 3’
DYS448 F: 5’ TGTCAAAGAGCTTCAATGGAGA 3’
R: 5’ TCTTCCTTAACGTGAATTTCCTC 3’

Table 1: Forward and reverse primers used in STRs sequencing.

Statistical analyses

ARLEQUIN 3.10 [15] software was used to calculate sex-specific allele frequencies, gene diversity, and heterozygosity. Allele frequency distributions observed for the loci in male and female samples were compared using an exact test of population differentiation. Deviations from Hardy-Weinberg equilibrium at each locus were tested for statistical significance using female data, according to Guo and Thompson [16]. ARLEQUIN 3.10 also was used to estimate the linkage disequilibrium (LD) between all pairs of loci by the exact test. All statistical tests and all calculations of standard deviations (SDs) were based on 10,000 randomizations. To determine linkage values and estimate a genetic map of the markers, we submitted the physical positions of the examined STRs to the Rutgers Map Interpolator application in the Rutgers Combined Linkage-Physical Map of the human genome (v.2) [http://compgen.rutgers.edu/Default.aspx] [17]. The Rutgers Map is a high-resolution genetic map that assembles the largest set of polymorphic markers publicly available. Included in the Rutgers Map are sequence-based positional data, recombination-based data, and genotype data from the CEPH and deCODE pedigrees, the Marshfield map, and the SNP Consortium. Genetic localizations and recombination values were estimated using the formula of Kosambi et al. [18]. The ChrX-STR application [http://www.chrx-str.org] was used to determine the polymorphism information content (PIC) [19], the power of discrimination (PD) for males and females [20], and the mean exclusion chance (MEC) [20-22].

Results and Discussion

Allelic designation and estimation of frequencies

Sequencing data were used to assign alleles in accordance with the ISFG recommendations [23]. Fragment sizes were analyzed by comparison with allelic ladders prepared in house by pooling sequenced alleles. Control DNA from cell line 9947A (Applied Biosystems) was used as reference standard. Repeat structures and alleles observed among the 10 STRs are summarized in Table 2. We examined in detail the structures of two loci that had not previously been characterized for forensic purposes, DXS1187 and DXYS218. Sequencing of 45 chromosomes identified DXS1187 as a tetrameric repeat marker, with 10 alleles and a (GATA)2-GAT-(GATA)n sequence structure. According to the recommended nomenclature [23], the proposed designation of DXS1187 alleles ranges from 12 to 20. For DXYS218, sequencing of 42 chromosomes revealed a repeat structure of (AGAT)2-GAT-AGAT-ACAT-(AGAT)n in both X and Y chromosomes and alleles ranging from 11 to 17.

Locus Name Repeat Motif Allele Range Control 9947A Reference
DXS6807 PF-N16-(GATA)1-N7-(GATA)2GAC(GATA)8-15-N99-PR Nov-18 Dec-14 [5]
DXS981 PF-N228-(TATC)11-17-N46-PR Nov-17 13.3-14.3 [6]
PF-N145-Δ(TT)-N81-(TATC)10-15(ATC)(TATC)1-N46-PR      
DXS6803 PF-N13-(TCTA)10-14-N88-PR 10-15.3 11.3-12 [7]
PF-N13-(TCTA)10-14(TCA)(TCTA)1-N88-PR      
DXS6809 PF-N41-(CTAT)7(ATCT)3-N9-(TATC)3(ATCT)3-N10-(ATCT)11-14-N28-PR 27-37 31-34 [8]
PF-N41-(CTAT)8-10(ATCT)3-N9-(TATC)3(ATCT)5-N10-(ATCT)11-16-N28-PR      
DXS1187 PF-N23-(GATA)2GAT(GATA)5-13(G/AATA)1(GATA)4-N125-PR Dec-20 18-19  
XHPRT PF-N77-(AGAT)7-17-N178-PR Jul-17 14-14 [9,10]
DXS7423 PF-N72-(TCCA)3-N8-(TCCA)10-15-N50-PR 13-18 14-15 [12]
DXYS267 PF-N1-(TATA)1(GATA)7-12(GACA)1(GATA)1-N158-PR(females) Oct-17 13-14 [13]
DXYS218 PF-N565-(AGAT)2GAT(AGAT)1(ACAT)1(AGAT)7-13-N2-PR Nov-17 15-16  
DYS448 PF-N48-(AGAGAT)11-13-N10-(AGAGAT)3-N14-(AGAGAT)6-10-N44-PR 17-23 - [14]

Table 2: Repeat motif and alleles observed in the 10 XY-STRs

Sequence data obtained from the other eight STRs were consistent with published structures [5-14]. As previously described [11] for the XHPRT marker of one sample, we observed an architecture composed by an AG dinucleotide deletion 48-bp downstream of 12-repeat (AGAT) sequence producing an allele fragment that is shorter by two bases. At the DXYS267 locus, corresponding to the DYS393 marker [13], Elucigene QST*R-XY PCR detects the Y-chromosomal del(TTAG) polymorphism located 90-bp downstream of the STR. Therefore, allele frequencies for the DXYS267 marker were estimated using only female data. Similarly, DXS6807 sequencing indicated that Elucigene QST*R-XY PCR amplifies a del(AATAA) polymorphism, 62-bp downstream of the STR, associated to the allele 11.

The exact test on female data showed no significant deviation from Hardy-Weinberg equilibrium. No significant differences were found for any loci in allele frequencies between the male and female subgroups. For this reason, samples were pooled, and the allele frequencies of the ten X and Y chromosomal (XY)-STRs in the Italian population were reported (Table 3). At each locus, 6-13 alleles were observed.

Allele DYS448 DXYS267 DXYS218 DXS6807 DXS981 DXS6803 DXS6809 DXS1187 XHPRT DXS7423
7                 0.0011  
8                 0.0033  
9                 0.0077  
10   0.0016       0.046     0.0077  
10.3           0.0042        
11   0.0016 0.0048 0.5306* 0.0033 0.3284     0.149  
11.3         0.0055 0.0188        
12   0.1511   0.0143 0.0188 0.2615   0.0011 0.3377§  
12.3         0.1093 0.1068        
13   0.4405 0.0048 0.0022 0.1347 0.1025   0.0044 0.2925 0.0475
13.3         0.287 0.1046        
14   0.2396 0.2636 0.2285 0.1777 0.0188   0.0155 0.1435 0.3653
14.3         0.1015 0.0063        
15   0.1479 0.4871 0.1976 0.0993     0.0265 0.0453 0.3609
15.3         0.0287 0.0021        
16   0.0161 0.2065 0.0254 0.0254     0.1104 0.011 0.1876
16.3         0.0077          
17 0.0106 0.0016 0.0332 0.0022 0.0011     0.1711 0.0011 0.0375
18 0.0565     0.0022       0.2693   0.0011
19 0.4028             0.3411    
20 0.3533             0.0607    
21 0.1519                  
22 0.0141                  
23 0.0106                  
27             0.0042      
28             0.0209      
29             0.0355      
30             0.023      
31             0.2114      
32             0.1653      
33             0.2803      
34             0.1736      
35             0.0628      
36             0.0146      
37             0.0084      
PIC - 0.658 0.59 0.609 0.815 0.76 0.788 0.73 0.717 0.642
Het - 0.704 0.612 0.637 0.801 0.798 0.804 0.752 0.74 0.717
PD f - 0.679 0.817 0.833 0.953 0.927 0.94 0.91 0.902 0.853
PD m 0.689 0.866 0.817 0.659 0.834 0.788 0.813 0.765 0.756 0.697
MEC - 0.463 0.385 0.609 0.815 0.76 0.788 0.728 0.716 0.642

Table 3: Allele frequencies of the 10 XY-STR markers in the Italian population. *AATAA deletion, 62-bp downstream of the repeat motif, observed with a frequency of 0,0298; § AG dinucleotide deletion, 48-bp downstream of the repeat motif, observed with a frequency of 0,0011. PIC: Polymorphism Information Content; Het: Observed Heterozygosity; PD: Power of Discrimination for females (f) and males (m); MEC: Mean Exclusion Chance.

The allele frequencies of the investigated X-STRs were similar to those reported in other European populations and in Italy [24-26]. No significant differences were detected when an exact test of population differentiations was performed to compare our marker frequencies with those obtained in other studies of Italian populations (100,000 steps in Markov chain).

Linkage and LD

Unlike autosomal STRs, gonosomal markers are syntenic. Both physical dependencies between loci (linkages) and dependencies between alleles at different associated loci (LD) may occur at gonosomal markers and can affect statistical analyses. In kinship testing, if loci are closely linked and in LD, it is highly indicated to use haplotype frequencies of clustered STRs rather than single STR frequencies [27-29].

Linkage measures the co-segregation of closely positioned loci within families and provides an estimate of the genetic distance between loci. Alleles in X-STR loci recombine in female meioses exclusively and at a frequency dependent upon their genetic distance. Table 4 summarizes the recombination fraction theta (?) values and the genetic distances between the considered X-STR markers obtained from the Rutgers Map.

Locus Name CytogeneticBand(NCBI v.37.1) PhysicalLocation(bp)(NCBI v.37.1) Genetic Location(cM)(Rutgers Map v.2) Distance(cM) Theta
DXS6807 Xp22.32 4743382 14.76 78.05 0.458
DXS981 Xq11.2 68197359 92.81 6.59 0.065
DXS6803 Xq21.31 86431170 99.4 8.72 0.086
DXS6809 Xq21.33 94938153 108.12 39.82 0.331
DXS1187 Xq26.1 131033197 147.94 1.71 0.017
XHPRT Xq26 133609215 149.64 34.55 0.299
DXS7423 Xq28 149710903 184.19    

Table 4: Physical and Genetic locations of the X-STR markers. Genetic and physical locations obtained from http://compgen.rutgers.edu and http://www.ncbi.nlm.nih.gov. Recombination fractions Theta estimated using Kosambi’s map function (1944).

Genetic distances confirm the distribution of our X-STRs into the typical four linkage groups on Xp22.32 (DXS6807), Xq11/21 (DXS981-DXS6803-DXS6809), Xq26 (DXS1187-XHPRT), and Xq28 (DXS7423). The linkage groups are located at distances ranging from 35 to 78 cM (? assessed from 0.30 to 0.46) and were regarded as indicative of independent genotypes. The DXS1187-XHPRT cluster spans approximately 1.7 cM, whereas markers in the DXS981-DXS6803-DXS6809 cluster are associated with distances of 6.59 cM and 8.72 cM, respectively. Similar genetic distances were published recently in a large recombination study [30].

LD measures the non-random associations of alleles at different loci at the population level. For closely linked markers, strong LD may be observed. A considerable LD implies a deviation of population-specific haplotype frequencies from the product of the corresponding allele frequencies. When this occurs, haplotype frequencies cannot be inferred from single-allele frequencies and instead must be estimated directly from population data.

LD was assessed for all possible pairwise comparisons of loci and between X and Y STRs. Significant LD was only detected for the closest markers, DXS1187-XHPRT (p=0.043 ± 0.001). This result was expected according to the distance between these two X-chromosomal loci (1.7 cM) and given the smaller number of observed haplotypes compared to those expected (37 vs. 99). However, after Bonferroni correction for multiple tests, no significant association was detected in all pairwise comparisons.

Because of the large number of possible haplotypes, a solid evaluation of LD between DXS1187-HPRT would have required an extremely large sample size. Thus, haplotype frequencies were estimated directly from our population (Table 5).

DXS981-DXS6803-DXS6809
Haplotype Frequency Haplotype Frequency
1112.331 0.0065 1412.334 0.0065
121133 0.0065 141331 0.0065
121233 0.0065 141332 0.0132
12.31131 0.0065 141333 0.0132
12.31133 0.0329 1413.333 0.0132
12.31134 0.0065 1413.329 0.0065
12.31228 0.0065 141435 0.0065
12.312.334 0.0065 1414.332 0.0065
12.31333 0.0065 14.31131 0.0132
12.31335 0.0065 14.31132 0.0065
12.313.331 0.0065 14.31133 0.0065
12.313.332 0.0065 14.31135 0.0065
131032 0.0065 14.311.332 0.0065
131029 0.0065 14.31232 0.0065
131132 0.0065 14.31233 0.0065
131134 0.0132 14.312.331 0.0065
131135 0.0065 14.312.332 0.0065
1311.329 0.0065 14.312.333 0.0065
131231 0.0065 14.312.334 0.0065
131233 0.0065 14.312.336 0.0065
131235 0.0065 14.31331 0.0065
131331 0.0065 14.31334 0.0065
1313.331 0.0065 14.313.331 0.0065
1313.332 0.0132 14.313.334 0.0065
1313.334 0.0065 151131 0.0065
13.31033 0.0065 151132 0.0065
13.31131 0.0263 151133 0.0065
13.31132 0.0132 151128 0.0065
13.31133 0.0132 1511.335 0.0065
13.31134 0.0263 151231 0.0065
13.31129 0.0065 151232 0.0132
13.31231 0.0263 151234 0.0065
13.31232 0.0065 151235 0.0132
13.31233 0.0395 151228 0.0065
13.31234 0.0263 1512.331 0.0065
13.31235 0.0065 1512.333 0.0065
13.312.331 0.0197 151333 0.0065
13.312.332 0.0132 151334 0.0065
13.312.333 0.0065 1513.331 0.0065
13.312.334 0.0065 15.31033 0.0065
13.31332 0.0065 15.31131 0.0065
13.31334 0.0065 15.312.331 0.0065
13.313.330 0.0065 15.31331 0.0065
13.313.331 0.0065 15.31333 0.0065
13.313.332 0.0132 161132 0.0065
13.313.334 0.0065 161234 0.0065
141131 0.0197 1612.331 0.0065
141133 0.0197 1612.334 0.0065
141137 0.0065 161331 0.0065
1411.332 0.0065 161332 0.0065
141230 0.0065 16.31131 0.0065
141231 0.0065 PIC 0.9867
141232 0.0132 Het 0.9939
141233 0.0132 PD f 0.9997
141234 0.0132 PD m 0.9869
141235 0.0065 MEC 0.9882
1412.333 0.0197    
DXS1187-XHPRT
Haplotype Frequency Haplotype Frequency
1314 0.0035 1812 0.0669
1411 0.0035 1813 0.081
1412 0.0141 1814 0.0387
1413 0.0035 1815 0.007
1417 0.0035 198 0.0035
1512 0.0035 1911 0.0493
1515 0.0035 1912 0.0986
1516 0.0035 1913 0.1232
1611 0.0176 1914 0.0458
1612 0.0458 1915 0.0282
1613 0.0282 207 0.0035
1614 0.0246 2011 0.0035
1615 0.0106 2012 0.0035
1711 0.0352 2013 0.0106
1712 0.0634 2014 0.0106
1713 0.0563 2015 0.007
1714 0.0317 PIC 0.9376
1715 0.007 Het 0.9132
1716 0.0035 PD f 0.9934
188 0.0035 PD m 0.9407
1811 0.0528 MEC 0.9344

Table 5: Haplotype frequencies of the DXS981-DXS6803-DXS6809 and the DXS1187-XHPRT clusters in the Italian population.

Marker informativity

Statistical parameters were calculated for the XY-STRs and for the two considered clusters (Table 5). The heterozygosities and PIC values for most of the markers exceeded 0.7. In particular, DXS981 was associated with 13 alleles and a particularly large PIC of 0.815. Conversely, DXYS218 was the least polymorphic/informative locus with a PIC of 0.590. The genetic diversity of DYS448, corresponding to the PD, was estimated as 0.689. MEC values ranged from 0.385 to 0.815 in the separated XY-STR markers, whereas increases to 0.988 and 0.934 were observed in cluster I (DXS981-DXS6803-DXS6809) and cluster II (DXS1187-XHPRT), respectively. The low MEC values we obtained for pseudoautosomal DXYS218 and DXYS267 STRs highlight the reduced efficiency of these markers compared to X-STR systems for kinship testing involving a daughter.

Conclusion

The application of X-STR marker analyses to forensics has been widely recognized, and several X-STR systems have been validated and adapted into multiplex amplification kits for forensic purposes. X-chromosome markers are especially helpful for deficiency cases, such as paternity testing without maternal genotype information or kinship analyses in which only remote relatives are available. X-chromosomal markers are more efficient than autosomal markers in these cases because they are associated with a larger MEC for a comparable PIC. In the present study, an Italian population was genotyped at 10 gonosomal STR markers using the commercially available Elucigene QST*R-XY kit. Most of these markers had already been validated for forensic use. We characterized the following two additional loci to determine their forensic utility: DXYS218, located in the pseudoautosomal region PAR, and DXS1187, located in the region Xq26.1 near the XHPRT locus. Moreover, we like to point out that this kit, widely available in the diagnostic, non-forensic genetic laboratories, can be also used for a fast segregation analysis of X-chromosome during prenatal or postnatal genetic linkage analysis.

References

  1. Butler JM (2011) Advanced Topics in Forensic DNA Typing: Methodology. (3rdedn) Elsevier Academic Press, San Diego.
  2. Pertl B, Kopp S, Kroisel PM, Tului L, Brambati B, et al. (1999) Rapid detection of chromosome aneuploidies by quantitative fluorescence PCR: first application on 247 chorionic villus samples.J Med Genet 36: 300-303.
  3. Giardina E, Spinella A, Novelli G (2011) Past, present and future of forensic DNA typing.Nanomedicine (Lond) 6: 257-270.
  4. ELUCIGENE QST*R, Instruction for Use. Tepnel Diagnostics Ltd. Abingdon, UK.
  5. Edelmann J, Szibor R (1999) Validation of the HumDXS6807 short tandem repeat polymorphism for forensic application.Electrophoresis 20: 2844-2846.
  6. Tabbada KA, De Ungria MC, Faustino LP, Athanasiadou D, Stradmann-Bellinghausen B, et al. (2005) Development of a pentaplex X-chromosomal short tandem repeat typing system and population genetic studies.Forensic SciInt 154: 173-180.
  7. Edelmann J, Szibor R (2003) The X-linked STRs DXS7130 and DXS6803.Forensic SciInt 136: 73-75.
  8. Edelmann J, Deichsel D, Plate I, Käser M, Szibor R (2003) Validation of the X-chromosomal STR DXS6809.Int J Legal Med 117: 241-244.
  9. Edwards A, Civitello A, Hammond HA, Caskey CT (1991) DNA typing and genetic mapping with trimeric and tetrameric tandem repeats.Am J Hum Genet 49: 746-756.
  10. Szibor R, Edelmann J, Hering S, Gomes I, Gusmão L (2009) Nomenclature discrepancies in the HPRTB short tandem repeat.Int J Legal Med 123: 185-186.
  11. Mertens G, Gielis M, Mommers N, Mularoni A, Lamartine J, et al. (1999) Mutation of the repeat number of the HPRTB locus and structure of rare intermediate alleles.Int J Legal Med 112: 192-194.
  12. Edelmann J, Deichsel D, Hering S, Plate I, Szibor R (2002) Sequence variation and allele nomenclature for the X-linked STRs DXS9895, DXS8378, DXS71, DXS6800, DXS713, GATA172D05, DXS7423 and DXS8377. Forensic SciInt 129:99-103.
  13. Dupuy BM, Gedde-Dahl T, Olaisen B (2000) DXYS267: DYS393 and its X chromosome counterpart.Forensic SciInt 112: 111-121.
  14. Redd AJ, Agellon AB, Kearney VA, Contreras VA, Karafet T, et al. (2002) Forensic value of 14 novel STRs on the human Y chromosome.Forensic SciInt 130: 97-111.
  15. Excoffier L, Laval G, Schneider S (2007) Arlequin (version 3.0): an integrated software package for population genetics data analysis.EvolBioinform Online 1: 47-50.
  16. Guo SW, Thompson EA (1992) Performing the exact test of Hardy-Weinberg proportion for multiple alleles.Biometrics 48: 361-372.
  17. Matise TC, Chen F, Chen W, De La Vega FM, Hansen M, et al. (2007) A second-generation combined linkage physical map of the human genome.Genome Res 17: 1783-1786.
  18. Kosambi DD (1944) The estimation of map distances from recombination values. Ann Eugen 12:172-175.
  19. Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms.Am J Hum Genet 32: 314-331.
  20. Desmarais D, Zhong Y, Chakraborty R, Perreault C, Busque L (1998) Development of a highly polymorphic STR marker for identity testing purposes at the human androgen receptor gene (HUMARA).J Forensic Sci 43: 1046-1049.
  21. Kishida T, Wang W, Fukuda M, Tamaki Y (1997) Duplex PCR of the Y-27H39 and HPRT loci with reference to Japanese population data on the HPRT locus.Nihon HoigakuZasshi 51: 67-69.
  22. Krüger J, Fuhrmann W, Lichte KH, Steffens C (1968) [On the utilization of erythrocyte acid phosphatase polymorphism in paternity evaluation].Dtsch Z GesamteGerichtl Med 64: 127-146.
  23. Bär W, Brinkmann B, Budowle B, Carracedo A, Gill P, et al. (1997) DNA recommendations. Further report of the DNA Commission of the ISFH regarding the use of short tandem repeat systems. International Society for Forensic Haemogenetics.Int J Legal Med 110: 175-176.
  24. Toni C, Presciuttini S, Spinetti I, Domenici R (2003) Population data of four X-chromosome markers in Tuscany, and their use in a deficiency paternity case.Forensic SciInt 137: 215-216.
  25. Bini C, Ceccardi S, Ferri G, Pelotti S, Alù M, et al. (2005) Development of a heptaplex PCR system to analyse X-chromosome STR loci from five Italian population samples. A collaborative study.Forensic SciInt 153: 231-236.
  26. Inturri S, Menegon S, Amoroso A, Torre C, Robino C (2011) Linkage and linkage disequilibrium analysis of X-STRs in Italian families.Forensic SciInt Genet 5: 152-154.
  27. Szibor R (2007) X-chromosomal markers: past, present and future.Forensic SciInt Genet 1: 93-99.
  28. Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, et al. (2003) Use of X-linked markers for forensic purposes.Int J Legal Med 117: 67-74.
  29. Tillmar AO, Mostad P, Egeland T, Lindblom B, Holmlund G, et al. (2008) Analysis of linkage and linkage disequilibrium for eight X-STR markers.Forensic SciInt Genet 3: 37-41.
  30. Hering S, Edelmann J, Augustin C, Kuhlisch E, Szibor R (2010) X chromosomal recombination-a family study analysing 39 STR markers in German three-generation pedigrees.Int J Legal Med 124: 483-491.
Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 11913
  • [From(publication date):
    September-2015 - Nov 19, 2017]
  • Breakdown by view type
  • HTML page views : 8113
  • PDF downloads : 3800
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords