alexa
Reach Us +44-1477412632
Genetic Diversity Analysis among Accessions of <em>Desmodium gangeticum</em> (L) DL with Simple Sequence Repeat (SSR) and Internal Transcribed Spacer (ITS) Regions for Species Conservation
ISSN: 2376-0214
Journal of Biodiversity, Bioprospecting and Development
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on Medical, Pharma, Engineering, Science, Technology and Business
All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Genetic Diversity Analysis among Accessions of Desmodium gangeticum (L) DL with Simple Sequence Repeat (SSR) and Internal Transcribed Spacer (ITS) Regions for Species Conservation

Verma V1*, Ahmad Hajia RF1, Tiwarib S2, Gandhi SG3 , Kumar A4 and Brindavanam NB4

1Department of Biotechnology, Shri Mata Vaishno Devi University, Sub-Post Office, Katra, Jammu and Kashmir, India

2Department of Biotechnology, School of Environmental Biology A.P.S University Rewa, Madhya Pradesh, India

3Plant Biotechnology Division, CSIR-Indian Institute of Integrative Medicine, Jammu and Kashmir, India

4Dabur Research and Development Centre, Dabur India Ltd, Ghaziabad, India

*Corresponding Author:
Verma V
Department of Biotechnology
Shri Mata Vaishno Devi University
Sub-Post Office, Katra, Jammu and Kashmir, India
Tel: 91 1991285692
E-mail: [email protected]

Received date: March 12, 2016; Accepted date: June 23, 2016; Published date: July 01, 2016

Citation: Verma V, Hajia RFA, Tiwarib S, Gandhi SG, Kumar A, et al. (2016) Genetic Diversity Analysis among Accessions of Desmodium gangeticum (L) DL with Simple Sequence Repeat (SSR) and Internal Transcribed Spacer (ITS) Regions for Species Conservation. J Biodivers Biopros Dev 3:159. doi:10.4172/2376-0214.1000159

Copyright:© 2016 Verma V et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Biodiversity, Bioprospecting and Development

Abstract

Desmodium gangeticum is one of the important species of ethno- medicinal plant. It finds its uses in numerous medicinal preparations including many industrial applications. Inspite of an important medicinal plant, till date little work have been conducted towards its molecular characterization and conservation. Therefore the present study was designed to bring out the relationships among different available accessions and study biodiversity conservation through simple sequence repeat (SSR) and inter transcribed spacer markers. The analysis revealed that intrapopulation mean genetic value (1.835) and Shannon (0.641) values vary among the accessions. However through AMOVA analysis, we observed that only a small variation exists among these accessions (P=1). The dendogram generated through distance matrix using the SIMQUAL-Dice Coefficient module of NTSYS pc ver matches to some extent with the PCA graph. In the barcode ITS marker analysis UPGMA shows the clustering of accessions into two groups. It is thus concluded that above based markers can be used for the population conservation and authentication of the above plant and could also be a lead for other medicinally important plants.

Keywords

Desmodiumgangeticum; SSR;ITS; PCA;Dendogram

Abbreviations

AFLP: Amplified Fragment Length Polymorphism; RFLP: Restriction Fragment Length Polymorphisms; SRAP: Sequence related Amplified Region; SNPs: Single Nucleotide Polymorphisms; EST: Expressed Sequence Tag ; AMOVA: Analysis of Molecular Variance; ISSR: Inter-simple Sequence Repeat; ITS: Internal Transcribed Spacer; PCoA: Principal Coordinate Analysis; PCR: Polymerase Chain Reaction; SAHN: Sequential Agglome rative Hierarchical Nested; SSR: Simple Sequence Repeat; UPGMA: Un-weighted Paired Group Method with Arithmetic Average; NCBI: National Center for Biotechnology Information; dNTPs: Deoxynucleotide Triphosphates

Introduction

Medicinal plants genetic resources play a vital role in the sustainable development of human therapeutic applications. The continuous and unchecked use of biodiversity resources however lead to severe constrain on the genetic diversity. Adequate and effective strategies thus needed to be developed towards conservation of these genetic resources. Desmodiumgangeticum is a sub-tropical perennial herb, distributed throughout the warmer parts of India, tropics of Africa that grows with angular branches, simple leaves, and purplish flowers. The plant is of high medicinal value, with applications such as antioxidant, anti-inflammatory activities [1]. The roots were used for antileishmanial, immunomodulatory [2], curability in premature ejaculation [3] and also in treatment of ulcers [4]. Different types of alkaloids have been extracted from this plant i.e. gangetin, gangetinin, desmodin, and desmocarpin [5]. Phospholipids, sterols, and flavones glycosides have also been extracted [6-8] have various pharmaceutical applications. Being high in demand and extensive exploitation of this spp., stresses burdened on framing and adequate conservation strategy for the same. Otherwise the plant in future will be in the red list.

Molecular markers are used for understanding the basis of genetic diversity. Various researchers have used different markers for studies such as Random Amplified Polymorphic DNAs [9], Simple Sequence Repeats [10], Restriction fragment length polymorphisms RFLP [11], Amplified Fragment Length Polymorphisms AFLP [12-14], SRAP [15], Single Nucleotide Polymorphisms, SNPs, Simple sequence repeats (SSR) [16-19]etc. Simple sequence repeat markers are being used in genetic relatedness, diversity identification for the conservation and utilization of germplasm resources [20-23]. The specific characteristics of these markers include their simplicity, effectiveness, abundance, hypervariability, reproducibility, codominant inheritance, and extensive genomic coverage [24]. With the increase of EST sequences in the public database, a large number of available sequences provide opportunities to identify and validate usefulness of these microsatellites at a low cost and in an efficient manner.

There is another marker known as intern transcribed spacer (ITS) markers or it even called as barcode. In plant genomes the nuclear ribosomal RNA (rRNA) genes occur in thousands of copies and are organized in tandem arrays while the 5S rDNA locus encodes the 5S rRNA genes, the 45S rDNA locus contains genes for 18S, 5.8S and 26S rRNA, which are transcribed as a single unit and then spliced. The 18S, 5.8S and 26S rRNA genes are separated by internal transcribed spacers ITS1 and ITS2 or ITS4, and the 45S transcription units themselves are separated from each other by non-transcribed intergenic spacers (IGS), extending from the 39 end of 26S rRNA to 59 end of the 18S rRNA coding regions [25].The ITS marker has been used in genetic variation studies [26] in genera of compositae plants. In the recent times it has been used in different plants like Epimedium [27], Panax [28] and Asarum plant [29] etc. Seeking the importance of above markers in the diversity study the study was designed to assess of genetic variability and diversity among different accessions of Desmodiumgangeticum using SSR and ITS. It is expected that the outcome will provide a genetic data and a theoretical basis for protection of the species which will contribute to monitoring of germplasm in future.

Materials and Methods

Plant material

In the present study, different accessions covering a wide range of the morphological variation were collected from different biodiversity regions of the India (Table 1). The collections were further maintained under in vitro and Green house conditions.

Plant code Source Date of collection Location
DG-1 kukrail,Lucknow 07-04-2009 26°54'34.9"N80°59'01.7"E
DG-2 Rishikesh,Uttarakhand 07-03-2009 30°05'14.3"N78°15'57.5"E
DG-3 Rajpipla,Gujrat 31-08-2009 21°52'17.9"N73°30'10.2"E
DG-4 Umarpura,Madhyapradesh  30-08-2009 22°23'00.7"N75°25'36.1"E

Table 1: Desmodiumgangeticum accessions collected from different geographical locations

DNA extraction

DNA was extracted with Plant Mini Kit (Qigen).Quantity and quality was assessed by electrophoresis in (0.8%) agarose gel stained with ethidium bromide (Amershco) using 0.5x TBE electrophoresis buffer at (95 V for 40 min). Quantitative estimates of sample DNA were made by nanodrop method (Thermo scientific).

Primer sequence

SSR primer sequences were available from the information available in NCBI. The sequences of SSR primers were selected on the basis of their proper properties of their broad coverage of the genome and their high levels of polymorphism. The inter transcribed spacer primers were chosen according to [26] to amplify the concerned region of the ribosomal DNA, which encompasses the 5.8S gene and both ITS-1 and ITS-4 regions. The primers were synthesised from Integrated DNA Technologies (USA).

SSR amplification

The PCR reaction mix up contained (30- 45 ng) DNA, 1 unit Taq DNA polymerase (New England biolabs), 2Mm of dNTPs mix (NEB),10 pmol primers and 10X buffer containing MgCl2 (NEB) in a total mix volume of 10 μl reaction with following cycling conditions; 94°C for 5 min, 32 cycles of 93°Cfor 1min,50°C for 1 min, 72°Cfor 1min, and a final extension temperature of 72°Cfor 5 min. The amplified products were separated on 1.8% (w/v) agarose gel at a constant voltage of 80v for 2 hours and were visualised in Bio-rad gel doc system.

Internal transcribed spacer assay

The entire ITS region, comprising ITS1, 5.8S, and ITS4, was amplified from genomic DNA of all the accessions with primers ITS1 (5/ TCCGTAGGTGAACCTGCGG 3/) and ITS4 (5/ TCCTCCGCTTATTGATATGC 3/) in a 100µl reaction in 10 times the reaction mix up used in SSR analysis. PCRs was performed with a Eppendorf PCR System using the conditions of 5 min at 95°C, followed by 32 cycles of 30 s at 94°C, 50 s at 55°C, and 1 min at 72°C, with a final extension step for 5 min at 72°C. PCR products were electrophoresed in 1.5% and purified with the Gel Extraction Kit (QIAGEN) according to the manufacturer’s manual. The purified products were sequenced at http://www.scigenom.com/. Searches for similar sequences were done using the BLASTN and X algorithm available in the National Centre for Biotechnology Information (NCBI,http://www.ncbi.nlm. nih.gov/BLAST/index.htm).

Data analysis

Simple Sequence Repeat (SSR): Most of the SSRs showed multiple bands which indicated that for a given SSR more than one allele was observed, which may reflect heterozygosity and/or segregation at the respective SSR marker. All the genotypes were scored for the presence and absence of the SSR bands. Some SSR were repeated twice and only the reproducible bands were scored and the data were entered into a binary matrix as discrete variables, 1 for presence and 0 for absence of the character and this data matrix was subjected to further analysis and imported in the form of excel file. POPGENE version 32 [30] was also used to estimate Gene diversity and Shannon’s information index (I) for co-dominant data markers. Principal Coordinates Analysis (PCoA) was performed with the software NTSYS version 2.2 [31]. The allelic SSR matrix was used for the analysis of molecular variance (AMOVA) using GenAlEx 6.41 [32]. AMOVA was used to estimate the partition of the genetic variation within and among accessions. The significance of the variance components was determined with a permutation test (999 replicates). SAHN module plot of NTSYS version 2.2 [32] was used for plotting the dendrogram to observe genetic relatedness and the robustness of the tree was tested using bootstrap analysis (1000 iterations).

Intertranscribedspacer

BLAST (NCBI’s web-based algorithm) was used to identify the query sequences. Each identification was made manually, taking E-value and maximum identity. Evolutionary analyses were conducted through MEGA6 [33].

Results and Discussions

There is growing concern about diminishing populations, loss of genetic diversity among medicinal plants. To some extinct DNA barcoding have been extensively used for species identification, diversity Barcode phylogeneny has been validated for conservation and identification purposessuch as in Panax [28] , Asarum plant [29] Epimedium[27] Gesneriaceae[34-37]. SSR based marker analysis used in the present study revealed small genetic divergence between different accessions. The 10 microsatellite primers (Table 2) were used in D. gangeticum and a total of 46 polymorphic bands sizes were generated.

S.No. Marker Position Sequence (5′→3′)
1 SBT/2013/01 Forward
Reverse
AGCAGGAGTACCCATGAAAGTCC
TATCACAGCACGAAGCGATAGATG
2 SBT/2013/02 Forward
Reverse
CACAACTCCATCAGAGGACAGAGA
CTGCTACGACATACGCCAGGC
3 SBT/2013/03 Forward
Reverse
CCGAAGATAACCAAACAATAATAGTAGG
ACTGTACGCCTCCCCTTCTC
4 SBT/2013/04 Forward
Reverse
GCTCTATGTTATTCTTCAATCGGGC
GGTCGGTCGGTACTCTGCTCTA
5 SBT/2013/05 Forward
Reverse
TGCCACCACAGCTTTCTCCTC
TATGAGAGAAGCGGTTGGCACG
6 SBT/2013/06 Forward
Reverse
GGGAGGGTAGGGAAGCAGTG
GCGAACCACGTTCATGAATGA
7 SBT/2013/07 Forward
Reverse
TTTACGCACCGCAGCACCAC
TGGACTCATAGAGGCGCAGAAAG
8 SBT/2013/08 Forward
Reverse
ACCTAGAGCCTAATCCTTCTGCGT
GAATGTGAATATCAGAAAGCAAATGG
9 SBT/2013/09 Forward
Reverse
GGGTAGTAAAGGAAAGAGAAGAAAGAG
CCACCTTCTCGTACTGTTCCATG
10 SBT/2013/10 Forward
Reverse
GATGGACACCCTTCAATTTATGGT
TCCAAGTAT CAG GCACACCAG C

Table 2: Microsatellite Primers used to assess genetic diversity in D.gangeticum.

Some primes gave distinct polymorphic products were highlighted in bold in Table 2 and rest of markers could not be amplified or produce faint bands were observed. One reason for the lack of amplification could be rapid genome modification. Microsatellite fragments ranged from 150 bp to 750 bp in size (Figure 1).

Biodiversity-Bioprospecting-genetic-relatedness

Figure 1: Gel pictures showing the genetic relatedness among D. gangeticum accessions using primers (A) SBT/2013/ 508 and (B) SBT/2013/510. M stands for marker and 1, 2, 3, 4 represent D. gangeticum accessions.

Examination of intra-population mean genetic diversity revealed the valueto be 1.8357 and mean Shannonto be 0.6411, (Table 3),Principal coordinates analysis (PCoA) and UPGMA cluster analysis (Figures2 and 3) was also performed to display the spatial allocation and to examine relationships between different accessions in populations thushelps us in understanding the relationships between them. Based on AMOVA analysis, we did not noticed any variation among Desmodiumgangeticum accessions, indicating statistically non significant genetic differentiations among populations (P = 1), which may perhaps also be due to small number of sample size. Here we can also state that the marker SSR, used in the present study displayed a relatively weak genetic diversity among Desmodiumgangeticum populations. Variability turned out to be in the same range in between the accessions which is probably the result of obligatory cross-pollination in this dioecious species. The genetic fragmentation of this species despite of its fragmented and isolated habitats did not happened yet.

Biodiversity-Bioprospecting-principal-coordinates

Figure 2: Three dimensional principal coordinates analysis (PCoA) of 4 accessions of D. gangeticum.


Biodiversity-Bioprospecting-UPGMA-dendogram

Figure 3: UPGMA dendogram analysis of accessions of D. gangeticum - Dg1, Dg2 and Dg3, Dg4 are clustered. This shows they are geographically less diverse.


Marker Gene Diversity Shanon Index(I*)
DG1 1.9737 0.6865
DG2 1.8648 0.6565
DG3 1.5505 0.5402
DG4 1.9538 0.6813
Mean 1.8357 0.6411

Table 3: Nei’s Gene diversity and Shanon Index of SSR.

In our study of Desmodiumgengaticum species the phylogenetic tree (Figure 4) obtained with the Neighbor-Joining (NJ) algorithm, 4 accessions of Desmodium were differentiated into two clusters viz (Dg1 and 2) and (DG3 and 4) which is in accordance with the geographical locations. BLAST Results showed maximum E-value in DG2 and maximum identity in DG4 (Table 4). Therefore the above results of both markers (SSR and intertranscribed) may provide a lead and implications for the conservation of this threatened species.

Biodiversity-Bioprospecting-Sequence-analysis

Figure 4: NCBI Blast results of the ITS sequences of Desmodiumgangeticum accessions.


Marker Accession Species E-value Max score
ITS DG1 Desmodiumgangeticum 0 1065
ITS DG2 Desmodiumgangeticum 8.00E-106 392
ITS DG3 Desmodiumgangeticum 0 935
ITS DG4 Desmodiumgangeticum 0 1101

Table 4: NCBI Blast results of the ITS sequences of Desmodiumgangeticum accessions.

Conclusion

The plants are not necessarily rare, indeed, management measures for the conservation and restoration of the above species is required. Otherwise the plant spp. may quickly become critically endangered if they are harvested in an unsustainable way as is happening in current era. Therefore considering the medicinal importance of this spp. the above discussed markers will probably provide productive application to the cultivation, conservation of genetic resources, assessment of genetic relationships and sustainable utilization of this natural gifted species.

Competing Interests

The authors declare that they have no competing interests.

Acknowledgement

The authors acknowledge to the Dabur Research Foundation New Delhi India for providing the financial assistance and SMVD University were the work was being carried in.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Article Usage

  • Total views: 9011
  • [From(publication date):
    December-2016 - Nov 19, 2019]
  • Breakdown by view type
  • HTML page views : 8876
  • PDF downloads : 135
Top