alexa Genetic Diversity of Variable Region Block 2 in the Merozoite Surface Protein-1 (MSP1) in Plasmodium falciparum Field Isolates from South-East of Iran | Open Access Journals
ISSN: 2470-6965
Malaria Control & Elimination
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Genetic Diversity of Variable Region Block 2 in the Merozoite Surface Protein-1 (MSP1) in Plasmodium falciparum Field Isolates from South-East of Iran

Ebrahimzadeh Adel1*, and Davoodi Tahareh2

1Department of Parasitology and Mycology, Dean of Department, Associated professor, Zahedan University of Medical Sciences, Zahedan, Iran and Membership of Infectious Diseases and Tropical Medicine Research Center, Zahedan University of Medical Sciences, Zahedan, Iran

2Department of Parasitology and Mycology, MSc Student, Zahedan University of Medical Sciences, Zahedan, Iran

*Corresponding Author:
Ebrahimzadeh Adel
Department of Medical Parasitology
and Mycology, Mashahire square
Medical college, Zahedan, Iran
Tel: +98541 2417760
E-mail: [email protected]

Received Date: March 22, 2014; Accepted Date: June 25, 2014; Published Date: July 04, 2014

Citation: Adel E, Tahareh D (2014) Genetic Diversity of Variable Region Block 2 in the Merozoite Surface Protein-1 (MSP1) in Plasmodium falciparum Field Isolates from South-East of Iran. Malar Chemoth Cont Elimination 3:124. doi:10.4172/ 2090-2778.1000124

Copyright: © 2014, Adel E, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Malaria Control & Elimination

Abstract

Merozoite surface protein 1 of (PfMSP-1) is a leading malaria vaccine candidate. However, extensive genetic diversity of this gene in field isolates of represents a major obstacle for the development of an effective vaccine against malaria. The present study was aimed at analysing genetic polymorphisms of K1, MAD20 and RO33 allelic types of MSP-1 block 2 among isolates from Sistan and Baluchestan, Iran. In this study a total of 94 infected persons from Sistan and Baluchistan Province of Iran, were included. Blood samples were collected from March 2011 to September 2012. Block 2 of the MSP-1 gene was genotyped by allele-specific nested polymerase chain reaction (PCR) after DNA extraction. Eighty-nine (94.7%) of the 94 samples were successfully amplified; 7 distinct MSP-1 genotypes were identified by size differences on agarose gels. MAD20 was the predominant MSP-1 allelic family identified in 46.1% (41/89) of the samples while RO33 family had the least frequency (7.9%). A total of 9/89 (10.1%) samples exhibited multiple infections with two alleles at PfMSP-1. The present study shows that the level of genetic diversity is relatively low in south-east of Iran and most of infections are composed of one clone, which is consistent with an area of low malaria transmission. These data are useful for malaria prevention and control in Iran.

Keywords

Genetic diversity; Merozoite Surface Protein -1; Plasmodium falciparum; Iran.

Introduction

Malaria is caused by four species of the genus Plasmodium protozoa. It is one of the most threatening parasitic diseases in man [1]. Although many efforts have been made to control this infectious disease, the global burden is still estimated at 216 million clinical cases every year resulting into 655,000 deaths [2]. The most malignant form of malaria is caused by Plasmodium falciparum [1]. In Iran, the majority of the clinical cases of malaria are caused by Plasmodium vivax (86%), while P. falciparum is responsible for the remaining 14% [3].

One of the most commonly used markers for genotyping of P. falciparum is merozoite surface protein 1 (MSP-1). Genetic polymorphism of this gene is thought to be a major obstacle for malaria vaccine design [4]. PfMSP-1 is synthesized during schizogony as a 190-200 kDa glycoprotein, located at the surface of P. falciparum merozoite and is a target of the hostʼs immune response, thus this is considered as a strong vaccine candidate [5].

Based on the degree of amino acid substitution, MSP-1 gene has been divided into 17 sequence blocks that are either conserved (semiconserved) or variable. The semi-conserved and variable regions are generally dimorphic for either K1 or MAD20; except for the block 2 which has an additional allele RO33, and block 4 which has one of four possibilities: MM, KK, MK, or KM [6]. Block 2 is a highly variable region near to the N-terminus of the gene and is under the strongest selection to maintain alleles within populations [4,7].

Iran is one of the countries placed in the Eastern Mediterranean Region which malaria endemicity is low in some of its regions [8]. Sistan and Baluchistan Province, in the South-East of Iran, is the falciparum malaria endemic area and considered as the oriental ecoepidemiological region of malaria [9].

In this study, we have analysed the genetic diversity in MSP-1 block 2 using nested PCR in Sistan and Baluchestan, Iran.

Materials and Methods

Sistan and Baluchistan Province lies on the south-east of Iran and the largest province in the country, with an area of 181,785 Km2 and a population of around 2.5 million, at the time of study [10,11]. This province has a subtropical climate, bordering Pakistan and Afghanistan from the east and Oman Sea from the south [10]. Malaria transmission occurs during the whole year with two peaks of May to August and October to November. P. vivax is the dominant species during the first peak; in second peak both P. vivax and P. falciparum infections are usually reported [12]. This survey was carried out on the population seeking care at the malaria health centers of Sistan and Baluchestan Province from March 2011 to September 2012.

Selection criteria of the cases were as follows: no history of treatment with anti-malarial drugs within the last month, residence in considered regions for over 6 months, patient satisfaction and signed consent form by older cases and parents of the younger ones. However 94 P. falciparum infected individuals who lived in four main districts of the province (Chabahar, Iranshahr, Nikshahr and Sarbaz) were included in the study.

About 2 ml of venous blood was taken from each patient. In order to confirm the presence of Plasmodium falciparum parasite, four drops of each sample was used for preparation of thick and thin blood smears. Then smears were stained by Giemsa method and evaluated by light microscopy. The remaining of each sample was collected in tubes containing EDTA and stored at -20°C until use.

Parasite genomic DNA was prepared using Fermentas Genomic DNA Purification Kit (Thermo Fisher Scientific Inc), according to the manufacturerʼs instructions and stored at -20°C until use.

The variable block 2 region of MSP-1 was amplified using a previously described nested PCR protocol [13]. An initial amplification of the outer regions of block 2 was carried out using a pair of oligonucleotides M1-OF: M1-OR. Allelic family specific primers (MAD20, K1 and RO33) were used in second amplification reaction. The sequence of the primers is presented in Table 1.

Primer Sequence 5′→3′ Specificity
M1-OF CTAGAAGCTTTAGAAGATGCAGTATTG Common block 2–Nest 1
M1-OR CTTAAATAGTATTCTAATTCAAGTGGATCA Common block 2–Nest 1
M1-MF AAATGAAGGAACAAGTGGAACAGCTGTTAC MAD20 family-specific–Nest 2
M1-MR ATCTGAAGGATTTGTACGTCTTGAATTACC MAD20 family-specific–Nest 2
M1-KF AAATGAAGAAGAAATTACTACAAAAGGTGC K1 family-specific–Nest 2
M1-KR GCTTGCATCAGCTGGAGGGCTTGCACCAGA K1 family-specific–Nest 2
M1-RF TAAAGGATGGAGCAAATACTCAAGTTGTTG RO33 family-specific–Nest 2
M1-RR CATCTGAAGGATTTGCAGCACCTGGAGATC RO33 family-specific–Nest 2

Table 1: Sequences of the oligonucleotide primers used to genotype block 2 of PfMSP-1[13].

Amplifications were performed on a thermal cycler (Biometra GmbH, Germany). The purified DNA from Plasmodium falciparum 3D7, 7G8 and Dd2 strains was provided by the Malaria Research and Reference Reagent Resource Center, American Type Culture Collection (Manassas, VA) and used as positive controls during all amplification reactions.

PCR products were electrophoresed on 2% agarose gels, and DNA visualized by UV transillumination after ethidium bromide staining. Positive controls and a 100bp Ladder Marker (Fermentas, Lithuania) were used to interpret the fragments sizes.

Results

In all, 94 patients with P. falciparum infection were selected in this descriptive cross-sectional study, 67 percent of them were male. Five patients were excluded from the study due to negative PCR outcome.

A total of 98 distinct fragments and seven different MSP-1 variants were detected among 89 patients, representing MAD20 (three variants), K1 (three variants) and RO33 (one variant) allelic families. The length variants of the PCR product were 170-210 base pairs (bp) for MAD20 and 160-200 bp for K1 (Table 2).

Family No. of samples PCR product size (bp) Frequency (%) Family No. ofsamples PCR product size (bp)
MAD20 41 170-210 46.1 MAD21 41 170-211
K1 32 160-200 35.9 K2 32 160-201
RO33 7 160 7.9 RO34 59.2 59.65
K1+MAD20 7 - 7.9 K1+MAD21 7 -
MAD20+RO33 2 - 2.2 MAD20+RO34 2 -
Total 89 - 100 Total 89 -

Table 2: Distribution of MSP-1 block 2 genotypes in Iran

Unlike the other two family types, the RO33 family did not show any polymorphism, only one variant (160 bp) was observed. The variant 190 bp of MAD20 and 200 bp of K1 allelic family MSP-1 demonstrated the most frequency.

The proportions of MAD20, K1 and RO33 types were 46.1%, 35.9% and 7.9%, respectively. Two allelic types (K1/MAD20, MAD20/RO33) were observed in 10.1% of infections, whereas no sample contained all three allelic types of MSP-1.

Discussion

Genetic structure of P. falciparum populations has an important role in the natural acquisition of immunity in malarial infections [14]. Therefore, survey on genetic structure of parasite population in clinical isolates from different endemic areas is necessary to control the disease and design of effective vaccines against P. falciparum.

In this study, nested PCR were used to screen allelic variations within the malaria vaccine candidate PfMSP-1 in south-east of Iran. Because nested PCR has been shown to exhibit a sensitivity and specificity of up to 94% in some trials [15], possesses a highthroughput capacity in comparison to other PCR modifications in this field of study, and is considerably more cost-efficient versus sequencing, we decided to adapt it to screen for P. falciparum MSP-1 N-terminal region variations.

Malaria transmission in south-east of Iran is low and seasonal with mainly symptomatic infections in adults [16]. A limited genetic diversity of PfMSP-1 block 2 was identified in this area. Seven different genotypes were identified at MSP-1 locus, which showed lower rates than that of a similar report in hypoendemic regions of Pakistan (25 genotypes) and Myanmar (14 different alleles); in contrast our findings was similar to Peru’s trials, where seven different alleles of MSP-1 were detected [7,17,18]. In the present study all three families of MSP-1 (K1, MAD20 and RO33) were observed. The predominant family was MAD20. These findings are similar to previous studies in Iran, Pakistan, Myanmar, Bangladesh and Colombia which demonstrated the predominance of the MAD20 [7,16,17,19,20]. By contrast, previous studies in Lao PDR, Zambia, Gabon, Congo and other African countries showed that K1 was the predominant allelic family [21-24]. Monomorphic band of RO33 allelic types in Iran were observed on agarose gel electrophoresis. This result differs from that of Bangladesh and Togo, where the RO33 family was polymorphic with four fragments [19,25]. Monomorphic band of RO33 was also identified in sub-Saharan Africa, Haiti, eastern and north eastern India [26-28].

In the study of Heidari, nine different variants of MSP-1 and relatively high polymorphisms were observed in P. falciparum isolates collected in south-east of Iran, whereas in the study conducted by Zakeri, high frequency of multiple genotypes and extensive genetic diversity were reported in the same location [9,16,29]. It seems that decrease in the rate of parasite transmission because of drought, decrease in immigration from neighboring countries (especially Afghanistan) that occurred in recent years are reasons for this finding.

Conclusion

A major finding of this study was that natural populations of P. falciparum in isolates from Iran exhibited relatively low genetic diversity in MSP-1 block 2. Moreover, the majority of infections were monoclonal with predominance of MAD20 allelic family of MSP-1.

Our findings are compatible with the general belief that Iran represents a low malaria transmission setting. These data are useful for malaria prevention and control in this area.

Acknowledgements

This study received financial support from Zahedan University of Medical Sciences.

We are specifically grateful to Dr Maliheh Metanat, Managing Director of Research Center for Infectious Diseases and Tropical Medicine, Zahedan University of Medical Sciences, for her unending assistance during the study.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

Article Usage

  • Total views: 11386
  • [From(publication date):
    December-2014 - Sep 23, 2017]
  • Breakdown by view type
  • HTML page views : 7652
  • PDF downloads :3734
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

[email protected]

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

[email protected]

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords