alexa Genetic polymorphism of CYP1A1 (T6235C) Gene as a Risk Factor for Polycystic Ovary Syndrome | Open Access Journals
ISSN: 2161-0932
Gynecology & Obstetrics
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Genetic polymorphism of CYP1A1 (T6235C) Gene as a Risk Factor for Polycystic Ovary Syndrome

Madhu Jain1*, Shuchi Jain1, Priyanka Pandey1 and Kiran Singh2

1Department of Obstetrics and Gynecology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, India

2Department of Molecular and Human Genetics, Banaras Hindu University, Varanasi, India

*Corresponding Author:
Madhu Jain
G-11, Lal Bahadur Shastri Colony
Karaundi, Varanasi, India
Tel: 91-415302988
E-mail: [email protected]

Received date: January 02, 2015; Accepted date: January 11, 2015; Published date: January 13, 2015

Citation: Jain M, Jain S, Pandey P, Singh K (2015) Genetic Polymorphism of CYP1A1 (T6235C) Gene as a Risk Factor for Polycystic Ovary Syndrome. Gynecol Obstet (Sunnyvale) 5:263. doi:10.4172/2161-0932.1000263

Copyright: © 2015 Jain M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.



Visit for more related articles at Gynecology & Obstetrics

Abstract

Objective: The aim of this study was to test the association of CYP1A1 gene T6235C polymorphism with
Polycystic Ovary Syndrome (PCOS).
Methods: In a case control study, 100 women with PCOS (Rotterdam criteria) and 100 age matched healthy controls were enrolled and compared with respect to CYP1A1 T6235C polymorphism. The clinical, biochemical and Sonographic parameters of wild type (TT), heterozygous (TC), and homozygous mutant (CC) genotypes in PCOS women were compared with that in controls.
Results: The risk ratio of bearing TC genotype was 1.3327 (p=0.32), and CC genotype was 2.6084 (p=0.14) in women with PCOS on the whole. However in PCOS women with the Sonographic presence of polycystic ovaries (PCO), the risk ratio became significant for TC genotype (OR=1.872; p=0.04) but not for CC genotype (OR=4.05; p=0.08). There was also a significant association of TC and CC genotypes with ovarian volume (p=0.000) as well as with waist circumference (p=0.03). However, the Total Testosterone, Fasting Glucose: Insulin ratio, LH: FSH ratio and HDL were insignificantly altered.
Conclusion: Both homozygous and heterozygous mutation of CYP1A1 confers an increased susceptibility to develop PCO. The abnormal folliculogenesis and hormone imbalance may be a result of CYP1A1 gene polymorphism due to toxin mediated endocrine disruption which along with other contributory factors may lead to full fledged polycystic ovary syndrome.

Keywords

Polycystic ovary syndrome; Polycystic ovaries; CYP1A1 T6235C polymorphism

Abbreviations

PCOS: Polycystic Ovary Syndrome; PCO: Polycystic Ovary; OR: Odds Ratio; HDL: High Density Lipids; LDL: Low Density Lipids; TT: Wild Genotype; TC: Heterozygous Genotype; CC: Homozygous Genotype

Introduction

Polycystic ovary syndrome (PCOS) is a heterogenous disorder [1-11] characterized by oligoanovulation with clinical or biochemical hyperandrogenemia. 5-10% of women in reproductive age group are affected [1]. The estimated prevalence of polycystic ovaries as diagnosed by ultrasonography in normal population is more than 20% [2-15]. PCOS has been said to be a spectrum disease with asymptomatic polycystic ovaries lying at one end and full fledged syndrome at the other end of the spectrum [4]. PCOS has a complex multifactorial etiology in which a number of predisposing genes interact with environmental factors to produce the disease [13-31]. CYP1A1 gene is located at 15q22-q24 and encodes cytochrome P450 enzymes involved in phase I of detoxification pathway. It is involved in oxidation of estradiol to 2-0H and 4-0H catechol estrogens in ovarian and extraovarian tissues [17-34]. Catechol estrogens are detrimental to granulosa cell replication and follicular growth [26]. Furthermore, many environmental procarcinogens like benzo[a]pyrene are activated to carcinogens by CYP1A1 enzymes [25]. These carcinogens can affect folliculogenesis and oogenesis [2,6,19]. Endocrine disrupters like organochlorines and dioxins cause induction of CYP1A1 enzymes [22,33] and oxidative stress [16], further aggravating the above changes. All these can lead to abnormal folliculogenesis and formation of cysts in ovaries by causing cell damage and cytotoxicity to the oocyte and supporting granulosa cells. Moreover, obesity which is an important component of PCOS has been shown to induce hepatic CYP1A1 expression in animal models [12]. CYP1A1 T6235C polymorphism has been shown to be associated with hypertension and endometrial cancer [15,27], both having obesity as an important risk factor and both are found in women with PCOS in later life. Thus, a possible correlation may exist between PCOS, its late metabolic sequelae and CYP1A1 gene expression. Three types of polymorphisms are known to affect CYP1A1 enzyme activity of which m1 (T6235C) and m2 (ile462val) are known to render the enzyme hyperinducible with increased activity [14,20,28]. Some studies have shown an association between these polymorphisms and PCOS [1,3,8] while some have not [30,32]. Since many of these studies have emphasized for further studies in different population groups, the present study was undertaken to find out the association of CYP1A1 polymorphism in women in North India and their susceptibility to develop PCOS.

Materials and Methods

This study was designed as a case control study and approved by the Ethical Committee of the institute. One hundred women with PCOS aged 18-30 years and a similar number of age matched healthy controls among North Indian women were enrolled for the study. Informed consent was taken from all the subjects were used to diagnose PCOS.

Inclusion criteria

Diagnosis of PCOS was made on presence of any 2 of the following 3 features {The Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Working Group, 2004 (revised 2003) consensus criteria}

1. Oligomenorrhoea (menstrual cycles ≥ 45 days or <8 cycles per year) and/or Amenorrhoea (more than 3 months),

2. Clinical hyperandrogenism (presence of acne, hirsuitism, Ferriman Gallwey Score ≥ 8 or alopecia) [9],

3. Polycystic ovaries on sonography (12 follicles in one or both ovaries, 2-9 mm in diameter and/or increased ovarian volume >10 ml).

Exclusion criteria

All patients with diabetes mellitus, hypertension, hyperprolactinemia, thyroid disorder, Cushing’s syndrome, acromegaly, premature ovarian failure, virilising adrenal or ovarian tumors and oral contraceptive pill use within last 6 months were excluded from the study. None of the subjects were alcoholic or smoker. Controls were defined as healthy age matched fertile women with regular cycles, absence of clinically apparent hyperandrogenism, obesity, any chronic illness and who were not taoral contraceptives pills in last six months.

Biochemical and Hormone Analysis

The blood samples were drawn on day 2 of normal menstrual cycle or progesterone induced bleeding after an overnight fast. Plasma glucose was measured by glucose oxidase peroxidise method (Selectra XL analyser, Vital Scientifics, Holland). Serum cholesterol, triglycerides, LDL and HDL levels were measured using kits by ERBA Diagnostic, Mannheim, Germany. Plasma Insulin, LH, FSH, Porlactin and total Testosterone were measured by chemiluminiscence method (Immulite 1000 System, Siemens) and TSH by IRMA kit (BARC, Mumbai, India).

Sonography

Pelvic sonography (Nemio30, Toshiba, Japan) was carried out in the department of Radiodiagnosis and Imaging on day 2 of the menstrual cycle in cases and controls both.

Genetic Analysis

The genetic analysis was carried out in the department of Molecular and Human Genetics. The blood samples were collected in tubes containing EDTA and stored at 4°C. Genomic DNA was extracted from peripheral leukocytes by salting out procedure [18]. T6235C variant of CYP1A1 gene was amplified using forward primer 5’CAGTGAAGAGGTGTAGCCGCT3’ and reverse primer 5’TAGGGAGTCTTGTCTCATGCC3’ by polymerase chain reaction (Bio-Rad laboratories Inc., Berkeley, California). Initial denaturation at 94°C for 5 minutes was followed by 35 cycles at 94°C for 60 seconds, at 63°C for 60 seconds and extension at 72°C for 60 seconds followed by final extension at 72°C for 10 minutes. PCR product was digested with msp1 restriction enzyme (Fermentas Life Sciences, Burlington, Canada) and left overnight at 37°C. Subsequently, the PCR products were separated using 2% agarose gel electrophoresis followed by visualization under UV illuminator after ethidium staining (Gel Documentation System, Alphalmager, USA).

Genotypes were expressed as TT for homozygous wild type (Normal), TC for heterozygous and CC for homozygous mutant genotypes. In normal TT genotype, a single band of 340 bp was produced. The two bands of 200 bp and 140 bp indicate homozygosity for C allele and presence of 3 bands of 340 bp, 200 bp and 140 bp indicate heterozygosity (TC, Figure 1).

gynecology-obstetrics-Agarose-gel

Figure 1: Agarose gel electrophoresis of CYP1A1 SNP of T6235C PCR product of 340 bp. The mutant allele gives rise to two fragments of 200 bp and 140 bp. Lane M is marker PUC/Hinf1. Lane 1 and 2 show wild type genotype (TT), Lane 3 shows heterozygous (TC) and lane 4 homozygous (CC) mutant genotypes.

Statistical Analysis

SPSS 16.0 for Windows (SPSS Inc, Chicago, IL, USA) was used for statistical analysis. All quantitative variables (Continuous, interval-scaled or ratio scaled) were expressed as mean ± standard deviation while for qualitative variables, a frequency along with their respective percentage was given. The distribution for each variable was tested for normality. The comparison of means was done by Student “t” test and Analysis of Variance (ANOVA) as required. For nominal (categorical) variables, Chi-square (2) test was used. For calculation of risk, Odds ratio (OR) and 95% confidence interval (CI) were calculated. A p-value less than 5% (p<0.05) was considered statistically significant.

Results

The demographic, anthropometric, biochemical, hormonal, and sonographic parameters of women with PCOS were compared with that of controls as shown in Table 1. Among the 100 women with PCOS, 82 had sonographic presence of polycystic ovaries (PCO). When genotype distribution and allele frequency were compared in these PCOS women with PCO (n=82) and controls (n=100, Table 2b), the risk ratio of bearing TC genotype was 1.872 (p=0.04) and CC genotype was 4.05 (p=0.08). The combined relative risk of TC and CC was also significantly high (OR=2.032, p=0.02). The demographi, anthropome tric, biochemical, hormonal and Sonographic parameters of PCOS women with PCO were compared in relation to the three genotypes, TT, TC, CC (Table 3).

Parameters PCOS (n=100) Control (n=100) p-value
Age (yrs) 23.99 ± 4.20 24.32 ± 2.43 0.50
Age at menarche (yrs) 12.73 ± 0.89 12.55 ± 0.74 0.12
BMI (kg/m2) 27.70 ± 2.42 23.35 ± 1.82 <0.001*
Waist circumference (inches) 35.91 ± 2.58 31.20 ± 1.76 <0.001*
Waist : hip ratio 0.86 ± 0.06 0.81 ± 0.03 <0.001*
LH (mIU/ml) 8.55 ± 5.03 2.71 ± 0.78 <0.001*
FSH (mIU/ml) 4.84 ± 1.55 4.59 ± 0.88 0.16
LH/FSH ratio 1.87 ± 1.05 0.59 ± 0.15 <0.001*
TSH (IU/ml) 1.49 ± 0.81 1.52 ± 0.78 0.84
Prolactin (ng/ml) 10.39 ± 6.03 9.37 ± 3.87 0.79
Total testosterone (ng/dl) 32.39 ± 26.21 12.16 ± 6.77 <0.001*
Fasting glucose (mg/dl) 92.81 ± 3.72 79.39 ± 4.25 <0.001*
Fasting insulin (mU/ml) 19.20 ± 2.45 11.72 ± 1.65 <0.001*
Glucose insulin ratio 4.90 ± 0.65 6.88 ± 0.93 <0.001*
Cholesterol (mg/dl) 204.87 ± 18.55 181.55 ± 22.93 <0.001*
Triglyceride (mg/dl) 83.76 ± 24.53 68.97 ± 17.72 <0.001*
LDL (mg/dl) 71.85 ± 24.42 48.62 ± 7.86 <0.001*
HDL (mg/dl) 48.61 ± 7.86 71.85 ± 24.42 <0.001*

Table 1: Demographic, anthropometric, biochemical, hormonal and sonographic parameters of the study population: PCOS women and controls (mean ± SD)

Polymorphism PCOS with polycystic ovaries (n=82) Control (n=100) OR 95% CI p value
No. % No. %
TT 34 41.4 59 59.0 1.0 - -
TC 41 50.0 38 38.0 1.872 1.02-3.45 0.04*
CC 7 8.5 3 3.0 4.05 0.98-16.70 0.08
TC+CC 48 58.0 41 41.0 2.032 1.22-3.677 0.02*
T 109 66.5 156 78.0 1.789 1.123-2.851 0.01*
C 57 28.5 44 22.0

Table 2B: Distribution of genotypes and allele frequencies of CYP1A1 T6235C Polymorphism in study population: PCOS with Polycystic Ovaries and controls

Parameters TT (n=34) TC (n=41) CC  (n=7) p-value
Age (yrs) 23.76 ± 3.86 23.90 ± 4.12 24.14 ± 5.64 0.97
Age at menarche (years) 12.52 ± 1.02 12.63 ± 0.73 13.28 ± 1.11 0.132
BMI (kg/m2) 29.08 ± 1.36 27.36 ± 2.47 29.08 ± 1.36 0.07
Waist circumference (inches) 36.63 ± 2.37 35.38 ± 2.72 37.57 ± 1.71 0.03*
LH (mIU/ml) 8.20 ± 5.65 8.90 ± 4.57 9.60 ± 2.11 0.73
FSH (mIU/ml) 4.79 ± 1.28 5.14 ± 1.67 4.67 ± 1.75 0.54
LH:FSH ratio 1.75 ± 1.09 1.85 ± 0.96 2.25 ± 0.79 0.49
TSH (IU/ml) 1.64 ± 0.86 1.38 ± 0.71 1.74 ± 1.30 0.33
Prolactin (ng/ml) 10.59 ± 7.31 10.17 ± 4.67 10.12 ± 8.62 0.95
Total Testosterone (ng/dl) 33.70 ± 29.31 28.50 ± 18.01 20.87 ± 9.72 0.34
Fasting blood glucose (mg/dl) 92.26 ± 3.86 93.47 ± 4.15 91.92 ± 1.90 0.33
Fasting insulin (mU/ml) 19.26 ± 2.27 19.06 ± 2.43 20.31 ± 3.43 0.46
Glucose insulin ratio 4.83 ± 0.45 4.98 ± 0.72 4.63 ± 0.76 0.32
Cholesterol (mg/dl) 205.76 ± 15.39 204.0 ± 15.73 209.0 ± 17.65 0.67
Triglyceride (mg/dl) 84.99 ± 27.27 78.56 ± 16.72 97.37 ± 38.99 0.13
LDL (mg/dl) 73.78 ± 26.08 66.90 ± 10.59 88.14 ± 48.44 0.06
HDL (mg/dl) 48.85 ± 8.78 48.64 ± 6.27 43.12 ± 7.85 0.17
Ovarian volume (ml) 11.11 ± 0.86 13.72 ± 1.34 15.84 ± 1.79 0.000*

Table 3: Demographic, anthropometric, biochemical, hormonal and sonographic profile of PCOS patients with polycystic ovaries according to the genotypes TT, TC and CC of CYP1A1 gene T6235C polymorphism

Genotype distribution and allele frequency of CYP1A1 T6235C polymorphism were compared between women with PCOS and controls (Table 2a).

Polymorphism PCOS (n=100) Control (n=100) OR 95% CI P value
No. % No. %
TT 50 50.0 59 59.0 1.0 - -
TC 43 43.0 38 38.0 1.3327 0.7509-2.3652 0.32
CC 7 7.0 3 3.0 2.6084 0.7173-9.4843 0.14
TC+CC 50 50.0 41 41.0 1.434 0.8236-2.5002 0.20
T 143 71.5 156 78.0 1.4 0.8985-2.2125 0.14
C 57 28.5 44 22.0

Table 2A: Distribution of genotypes and allele frequencies of CYP1A1 T6235C Polymorphism in study population: PCOS women and controls

TC genotype was 1.3327 times more (p=0.32) and CC genotype was 2.6084 times more (p=0.14) in women with PCOS. We found non-significant difference among clinical parameters (age, age at menarche, and body mass index except waist circumference). The waist circumference was significantly more (p=0.03) in CC genotype as compared to TT and TC genotypes. The hormonal and biochemical parameters (LH, FSH, LH: FSH ratio, Total Testosterone, LDL, HDL and Fasting glucose: Insulin ratio) also did not reveal any significant alteration.

On ultrasonography, the mean ovarian volume was significantly more in both TC and CC genotypes as compared to TT genotype in women with PCOS (p=0.000). A small sample size could be responsible for some insignificantly altered values of certain metabolic and hormonal parameters such as fasting Glucose: Insulin ratio, cholesterol, triglycerides, LH: FSH ratio, and total testosterone levels.

Discussion

We found an increased risk of CYP1A1 T6235C polymorphism (both homozygous and heterozygous) in women with PCOS. In PCOS women with sonographic presence of polycystic ovaries (PCO), this risk ratio was statistically significant (p<0.05). Moreover we also found the ovarian volume to be significantly more in both homozygous (CC) and heterozygous (TC) mutants as compared to normal genotype (TT) in PCOS women with polycystic ovaries. Interestingly, the waist circumference was also significantly more in CC genotype as compared to TT and TC genotypes. It might be possible that obesity is playing a contributory role in CYP1A1 gene expression as found in animal models [12,13]. Thus our results suggest that both homozygous and heterozygous mutations of CYP1A1 have a significant association with polycyst formation in the ovaries and confer an increased susceptibility to develop Polycystic Ovary Syndrome. The abnormal folliculogenesis and hormone imbalance may be a result of CYP1A1 gene polymorphism which along with other contributory factors may play an important role in the development of full fledged polycystic ovary syndrome.

They were the first to study a relation between CYP1A1 T6235C polymorphism and polycystic ovaries in South Indian women [3]. They found a significant association of CC genotype (OR=3.764, 95%CI=1.308-10.838, p=0.0139) with PCO while we found an OR of 2.6084 (p=0.14) between CC genotype and PCOS. Whereas they took sonographic presence of polycystic ovaries as essential criteria to diagnose PCOS, we used Rotterdem criteria to select such women for the study. When we considered Sonographic presence of polycystic ovaries as an essential criteria, our results were similar (OR=4.05; 95% CI=0.98-16.70) but not significant (p=0.08). In terms of TC genotype [3] found an OR of 1.3729 (p=0.2824) while our results on the contrary showed a significant association between TC genotype and PCOS with PCO (OR=1.872, 95% CI=1.02-3.45, p=0.04). The differences between these two studies may be due to different environment, ethnicity and diet between south and north Indian population.

They did not find a statistically significant difference between PCOS cases and controls (p>0.05) in Turkish population in terms of CYP1A1 T6235C polymorphism. However, they found that TC genotype was 1.78 times more in women with PCOS (p=0.088) as compared to controls but TT genotype was more in controls. They did not find any CC genotype in the study population. Thus ethnicity seems to play an important role in genotype expression [30].

Although [1] showed a significant association of CYP1A1 gene polymorphism with PCOS in Turkish population, [32] showed lack of such association in Chinese population. However, these studies cannot be compared with the present study as they studied ile462val polymorphism of CYP1A1 gene [23,24,35] also found definite risk of developing PCOS in association with polymorphism of C variant of CYP1A1 rs4646903 (T>C) in Turkish and Indian population on the basis of meta-analysis.

There are some limitations in such population based genetic association studies due to small sample size, difference in criteria of defining PCOS, inclusion of PCOS/PCO, narrowed down effect estimates, multiple testing and variation in selection of controls. A metaanalysis of individual studies is another way to deal with the genetic –association data. However, polymorphism of CYP1A1 gene might be used as a biomarker in future for the diagnosis of this heterogenous and metabolic disorder.

Since none of the earlier studies compared clinical and biochemical parameters of PCOS with CYP1A1 genotypes, the results of our study are novel in that they point towards a possible relation between PCOS, PCO, environment and CYP1A1gene expression. The importance of further research involving larger groups of women and incorporating the clinical and biochemical parameters of PCOS in the study design cannot be over emphasized.

Acknowledgement

We are thankful to the Department of Molecular and Human Genetics, Banaras Hindu University for genetic analysis of blood samples.

References

  1. Akgul S, Derman O, Alikaşifoglu M, Aktaş D (2011) CYP1A1 polymorphism in adolescents with polycystic ovary syndrome. Int J GynecolObstet 112: 8–10.
  2. Babineau KA, Singh A, Jarrell JF, Villeneuve DC (1991) Surface epithelium of the ovary following oral administration of hexachlorobenzene to the monkey. J SubmicroscCytolPathol 23: 457-464.
  3. Babu KA, Rao KL, Kanakavalli MK, Suryanarayana W, Deenadayal M, et al. (2004) CYP1A1, GSTM1 and GSTT1 genetic polymorphism is associated with susceptibility to polycystic ovaries in South Indian women. Reprod Biomed Online 9: 194-200.
  4. Balen AH, Conway GS, Kaltsas G, Techatraisak K, Manning PJ, et al. (1995) Polycystic ovary syndrome: the spectrum of the disorder in 1741 patients. Hum Reprod 10: 2107-2111.
  5. Clayton RN, Ogden V, Hodgkinson J, Worswick L, Rodin DA, et al. (1992) How common are polycystic ovaries in normal women and what is their significance for the fertility of the population? ClinEndocrinol 37: 127-134.
  6. Enan E, Moran F, VandeVoort CA, Stewart DR, Overstreet JW, et al. (1996) Mechanism of toxic action of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in cultured human luteinized granulosa cells. Reprod. Toxicol. 10: 497-508.
  7. Esinler I, Aktas D, Otegen U, Alikasifoglu M, Yarali H, et al. (2008) CYP1A1 gene polymorphism and polycystic ovary syndrome. ReprodBioMed Online 16: 356-360.
  8. Farquhar CM, Birdsall M, Manning P, Mitchell JM, France JT (1994) The prevalence of polycystic ovaries on ultrasound scanning in a population of randomly selected women. Aust N Z J ObstetGynaecol 34: 67-72.
  9. Ferriman D, Gallwey JD (1961) Clinical assessment of body hair growth in women. J ClinEndocrinolMetab 21: 1440-1447.
  10. Franks S (1995) Polycystic ovary syndrome. N Engl J Med 333: 853–861.
  11. Goodarzi MO, Azziz R (2006) Diagnosis, epidemiology, and genetics of the polycystic ovary syndrome.  Best Pract Res ClinEndocrinolMetab 20: 193-205.
  12. Hakkak R, Shaaf S, Dunn H, MacLeod S, Fuchs G, et al. (2008) Effects of obesity and 7,12-dimethylbenz(a)anthracene (DMBA) treatment on hepatic CYP1A1 expression in ovariectomized obese Zucker rats. The FASEB Journal 22: 886.1
  13. King RA, Rotter JI, &Motulsky AG (2002) The genetic basis of Common Diseases. 2nd ed, Oxford University Press, New York.
  14. Kiyohara C, Hirohata T, Inusuka S (1996) The relationship between aryl hydrocarbon hydroxylase and polymorphisms of the CYP1A1 gene. Jpn J Cancer Res 87: 18-24.
  15. Lanca V, Coelho C, Pego P, Moreira H, Sardinha L, et al. (2002) P-304: Association of CYP1A1, ACE and p22phox polymorphisms with essential hypertension in postmenopausal women. Am J Hypertens 15: A140-A141.
  16. Loft A, Ziebe S, Erb K, Rasmussen PE, Agerholm I, et al. (2005) Impact of follicular-fluid meiosis-activating sterol in an albumin-based formulation on the incidence of human pre-embryos with chromosome abnormalities. FertilSteril 84 (Suppl 2): 1269-1276.
  17. Martucci CP, Fishman J (1993) P450 enzymes of estrogen metabolism. PharmacolTher 57: 237–257.
  18. Miller SA, Dykes DD, Polesky HF (1988) A simple salting-out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16: 1215.
  19. Neal MS, Zhu J, Holloway AC, Foster WG (2007) Follicle growth is inhibited by benzo-[a]-pyrene, at concentrations representative of human exposure, in an isolated rat follicle culture assay. Hum Reprod 22: 961–967.
  20. Petersen DD, McKinney CE, Ikeya K, Smith HH, Bale AE, et al. (1991) Human CYP1A1 gene: cosegregation of the enzyme inducibility phenotype and an RFLP. Am J Hum Genet 48: 720-725.
  21. Polson DW, Adams J, Wadsworth J, Franks S (1988) Polycystic ovaries – a common finding in normal women. Lancet1 870-872.
  22. Schrenk D (1998) Impact of dioxin type induction of drug metabolizing enzymes on the metabolism of endo-xenobiotics. BiochemPharmcol 55: 1155-1162.
  23. Shen W, Li T, Hu Y, Liu H, Song M (2013) CYP1A1 gene polymorphisms and polycystic ovary syndrome: a meta-analysis and meta-regression. Genet Test Mol Biomarkers 17: 727-735.
  24. Shen W, Li T, Hu Y, Liu H, Song M (2014) Common polymorphisms in the CYP1A1 and CYP11A1 genes and polycystic ovary syndrome risk: a meta-analysis and meta-regression. Arch GynecolObstet 289: 107-118.
  25. Son DS, Roby KF, Rozman KK, Terranova PF (2002) Estradiol enhances and estriol inhibits the expression of CYP1A1 induced by 2,3,7,8 – tetrachlorodibenzo-p-dioxin in a mouse ovarian cancer cell line. Toxicology 176: 229-243.
  26. Spicer LJ, Hammond JM (1989) Catecholestrogens inhibit proliferation and DNA synthesis of porcine granulosa cells in vitro: comparison with estradiol, 5 alpha-dihydrotestosterone, gonadotropins and catecholamines. Molecular and Cellular Endocrinology 64: 119–126.
  27. Sugawara T, Nomura E, Sagawa T, Sakuragi N, Fujimoto S (2003) CYP1A1 polymorphism and risk of gynecological malignancy in Japan. Int J Gynecol Cancer 13: 785-790.
  28. Taioli E, Crofts F, Trachman J, Bayo S, Toniolo P, et al. (1995) Radical differences in CYP1A1 Genotype and function. ToxicolLett 77: 357-362.
  29. The Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Working Group 2004 Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome (PCOS).2004 Human Reprod 19: 41–47.
  30. Unsal T, Konac E, Yesilkaya E, Yilmaz A, Bideci A, et al. (2009) Genetic polymorphisms of FSHR, CYP17, CYP1A1, CAPN10, INSR, SERPINE1 genes in adolescent girls with polycystic ovary syndrome. J Assist Reprod Genet 26: 205–216.
  31. Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, et al. (1999) Thirty-seven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. ProcNatlAcadSci USA 96: 8573–8578.
  32. Wang B, Wang J, Liu J, Ni F, Yan J, et al. (2009) Lack of an association between CYP1A1 gene Ile462Val polymorphism and polycystic ovary syndrome in Chinese. Endocr 36: 16-19.
  33. Whitlock JP (1999) Induction of cytochrome P450A1. Ann Rev, PharmacolToxicol 39: 103-125.
  34. Yager JD, Liehr JG (1996) Molecular mechanisms of estrogen carcinogenesis. Annual Review of Pharmacology and Toxicology 36: 203–232.
  35. Zawadski JK, Dunaif A (1992) Diagnostic criteria for polycystic ovary syndrome towards a rational approach. In: Polycystic Ovary Syndrome (eds A Dunaif, JR Givens, FP Haseltine, and GR Merriam), pp 377–384. Blackwell Scientific Publications, Oxford.
Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11747
  • [From(publication date):
    January-2015 - Aug 21, 2017]
  • Breakdown by view type
  • HTML page views : 7972
  • PDF downloads :3775
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords