alexa Identification of a Universal Marker for Detecting Possible Mutation in Botrytis cinerea Isolates Associated with Virulence | Open Access Journals
ISSN: 2157-7471
Journal of Plant Pathology & Microbiology
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Identification of a Universal Marker for Detecting Possible Mutation in Botrytis cinerea Isolates Associated with Virulence

Moytri RoyChowdhury1,2*, Jake R. Erickson1 , Peter Rafael Ferrer2, Brian Foley3, Shannon Piele2, James Titius2, Kshitij Shrestha1 and Caleb Fiedor2

1Department of Biological Sciences, Idaho State University, 650 Memorial Dr. Gale Life Sciences Building, Pocatello, ID 83209, USA

2Department of Biology, Fresno Pacific University, 1717 S Chestnut Ave, Fresno, CA 93702, USA

3Los Alamos National Laboratory, Santa Fe, NM 87545, USA

*Corresponding Author:
Moytri RoyChowdhury
Department of Biological Sciences, Idaho State University
650 Memorial Dr. Gale Life Sciences Building
Pocatello, ID 83209
USA
Tel: +2082822149
E-mail: roycmoyt@isu.edu

Received date: February 07, 2017; Accepted date: February 21, 2017; Published date: February 27, 2017

Citation: Moytri RoyChowdhury, Jake R. Erickson, Peter Rafael Ferrer, Brian Foley, Shannon Piele, et al. (2017) Identification of a Universal Marker for Detecting Possible Mutation in Botrytis cinerea Isolates Associated with Virulence. J Plant Pathol Microbiol 8: 397. doi: 10.4172/2157-7471.1000397

Copyright: © 2017 Moytri RoyChowdhury, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Plant Pathology & Microbiology

Abstract

Botrytis cinerea sporadically infects plants in Mediterranean climates and contributes to a significant crop loss every year. Diseases caused by B. cinerea can affect many crops and are of particular concern to strawberry growers in California, which is the major state for fresh strawberry production in the United States. This study looks at genetic mutations, and the subsequent phenotypical changes, of several strains of B. cinerea obtained from plant tissues. It was found that strains with four nucleotide insertions were more virulent than their wild type counterparts. Strains with single nucleotide polymorphisms had conidia smaller or similar in size to the wild type strains and exhibited similar virulent properties as the wild type. We also observed identical mutations of fungal samples obtained from different plant tissues from Asia.

Keywords

B. cinerea; Isolates; Virulence; Strawberries; Mutation

Introduction

B. cinerea Pers.: Fr and related Botrytis species are common and economically important pathogens affecting a wide variety of vegetables and ornamental crops [1]. While there are 25-30 necrotropic plant pathogens closely related to B. cinerea Pers.: Fr (teleomorph Botryotinia fuckelian (de Bary) Whetzel, B. cinerea is the most comprehensively studied [2,3]. The added attention is due to the vast economic effects caused by the fungus’s widespread host range, infecting over 200 plant species, and by its involvement in pre- and post-harvest crop losses worldwide, which cause vast economic effects [2,4]. The ability to infect diverse plant species and tissues under a wide-range of environmental conditions is aided by B. cinerea’s ability to survive in topsoil, which cause it to be very persistent in nature. It is also aided by dispersed airborne conidia or ascospores, which allow B. cineria to infect host tissue and sexually reproduce [5].

The conidia, which are commonly found in large quantities in necrotophic host tissue, are the main sources of infection by B. cinerea [2]. In the presence of high levels of humidity (>93%), germination is activated by physical and chemical signals. This activation is a cAMPdependent pathway and MAP kinase cascade, which are involved in signal transductions that lead to germination [2]. Because of their low degree of differentiation, the ability of B. cinerea appressoria to physically penetrate intact host tissue seems to be limited and probably needs to be supported by secreted lytic enzymes [6]. B. cinerea is found to secrete a number of endopolygalacturonases, which are used to soften cell walls [7]. Although, the ability to penetrate the cell wall of host tissues might need the action of specific chitin synthase isoenzymes, which is shown to be necessary for pathogenicity [8,9]. Once penetration has occurred, it is typically followed by the prompt death of the host cell.

The fungus is phenotypically characterized by grey mold on the tissue that it infects [10]. The pattern of growth can vary in color and density, but in general the pathogen has gray mycelium that differentiates it from other fungi [11]. It occurs sporadically in Mediterranean climates and contributes to a significant crop loss every year, making B. cinerea an extreme nuisance in California [12].

Out of all the Californian crops that B. cinerea is known to infect, it has one of the most undesirable effects on its sixth most valuable crop, the field strawberry (Fragaria ananassa). California is the major state for strawberry production in the U.S., accounting for over 80% of the fresh market product grown [13]. Second to grapes, strawberries are the most important cultivated fruit of the berry family worldwide with 3.82 million tons produced per year [14]. B. cinerea causes one of the most prominent post-harvest molds that cause quality deterioration of strawberries and other fruits in the field and during refrigeration storage [15,16]. Gray mold can cause up to a 30% to 40% loss of the harvest where chemical methods of pest management are not practiced. This loss can reach 50% to 60% in areas of acute infestations, in which the economic loss will be up to 100% [15].

Botryticides and fungicides are currently used to combat these losses, but both come with their own sets of problems. The use of botryticides, despite their latest availability, results in continued crop loss, while the use of fungicides is becoming increasingly restricted or forbidden because of their unfavorable effects on ecosystem and human health [12]. Fungicides are still used for disease control, but the fungi are adapting quickly to these drugs via mutations, including the insertion of retroposon sequences into gene promoters [17,18]. As a result of recurring fungicide treatments, resistant strains are quickly developing [19]. Three types of increasing multidrug resistance populations of B. cinerea have appeared since the mid 1990’s in Europe [17]. After studying the immerging resistant strains, a few distinctive fungicide resistance mechanisms have been identified in both field and greenhouse environments [20,21]. It has been anticipated that by continually selecting multi-resistant strains, chemical control of B. cinerea in the field will become increasingly difficult [17].

With the increased resistance and concern for human health in the last decade, there is a need for a greater understanding of the development of this resistance epidemic in order to create resilient and maintainable disease control methods [12]. A rapid and convenient method to detect resistant mutations is vital for understanding and managing fungicide resistance [22]. In using genomics to continue the study of mutations in B. cinerea, it is likely that the identification of resistance causing mutations can lead to effective disease control methods. Therefore, the objectives of this research were to: i) identify genetic diversity of Botrytis isolates obtained from strawberries in California using sequencing analysis, ii) identify morphological and phylogenetic diversity of California’s population of Botrytis in strawberries, iii) use pathogenicity assay to detect if the diversity has an impact on virulence. This study was undertaken to characterize and identify the different species of Botrytis using sequencing analysis and morphology. In addition, pathogenicity studies were undertaken to understand the role of these species in fruit decay [23].

Materials and Methods

Fungal isolate collection

We obtained a total of 79 pure culture isolates from Driscoll’s Strawberry Associates, Watsonville, California (Table 1). The isolates were grown on Potato Dextrose Agar (PDA) with 0.01% tetracycline at 27°C for a period of 21 days. Plugs (0.6 cm diameter) of developed hyphae were placed in the center of a PDA plate and the cultures were routinely transferred every 3 week.

Isolate number Isolated from Type of infection Area Ranch Date Note
BOT01 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT02 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT03 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT04 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT05 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT06 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT07 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT08 Strawberry postharvest Oxnard 04.2156 Feb. 2008 Fruit
BOT09 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT10 Strawberry, El Dorado field Oxnard Lennox Mar.2008 Fruit
BOT11 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT12 Strawberry, El Dorado field Oxnard Lennox Mar.2008 Fruit
BOT13 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT14 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT15 Strawberry, El Dorado field Oxnard Lennox Mar.2008 Fruit
BOT16 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT17 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT18 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT19 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT20 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT21 Strawberry, El Dorado field Oxnard Lennox Mar.2008 Fruit
BOT22 Strawberry, El Dorado field Oxnard Lennox Mar.2008 Fruit
BOT23 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT24 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT25 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT26 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT27 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT28 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT29 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT30 Strawberry, El Dorado field Oxnard Beardsley Mar.2008 Fruit
BOT31 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT32 Strawberry, El Dorado field Oxnard Sammis Mar.2008 Fruit
BOT33 Strawberry, El Dorado field Oxnard Lennox Mar.2008 Fruit
BOT34 Raspberry, Pacifica field Oxnard Lennox Mar.2008 Fruit
BOT35 Raspberry, Pacifica field Oxnard Lennox Mar.2008 Fruit
BOT36 Raspberry, Pacifica field Oxnard Lennox Mar.2008 Fruit
BOT37 Raspberry, Pacifica field Oxnard Sammis Mar.2008 Fruit
BOT38 Raspberry, Pacifica field Oxnard Beardsley Mar.2008 Fruit
BOT39 Raspberry, Pacifica field Watsonville   May.2008 Cane infection
BOT40 Raspberry, Pacifica field Watsonville   May.2008 Cane infection
BOT41 Raspberry, Pacifica field Watsonville   May. 2008 Cane infection
BOT42 Raspberry, Pacifica field Watsonville   May. 2008 Cane infection
BOT43 Raspberry, Pacifica field Watsonville   May. 2008 Cane infection
BOT44 Raspberry, Pacifica field Watsonville   May.2008 Cane infection
BOT45 Raspberry, Pacifica field Watsonville   May.2008 Cane infection
BOT46 Strawberry field Watsonville   May. 2008 Cane infection
BOT47 Strawberry field Watsonville   May. 2008 Cane infection
BOT48 Strawberry field Watsonville   May. 2008 Cane infection
BOT49 Strawberry field Watsonville   May. 2008 Cane infection
BOT50 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT51 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT52 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT53 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT54 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT55 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT56 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT57 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT58 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT59 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT60 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT61 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT62 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT63 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT64 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT65 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT66 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT67 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT68 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT69 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT70 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT71 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT72 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT73 Strawberry field Salinas Davis Jun. 2008 Fruit
BOT74 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT75 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT76 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT77 Strawberry field Watsonville TCR Jun. 2008 Fruit
BOT78 Blackberry field Watsonville TCR 7/11/2014 Leaf Petiole
BOT79 Strawberry field Nursery Tule Lake 6/19/2014 Fruit

Table 1: List of isolates collected and used for morphological, phylogenetic, and pathogenic analysis.

Microscopy

Microscopy was done using a phase contrast microscope (M4000-D Swift Instruments Inc, Japan). Measurements were taken at 1000 x magnification using oil immersion. Mycelia used in this study were 21 days old. Mycelia were placed on a slide and stained with methylene blue prior to observation under the microscope. We measured the conidia length and width for all 79 isolates, each with three replicates. Measurements were done using the ocular micrometer after calibrating the microscope with the stage micrometer. Photographs were taken with 8-megapixel iSight camera with 1.5 u pixels.

DNA extraction

21-day-old Mycelium was used to extract DNA from each of the isolates. DNA was extracted from the fungal isolates using PrepMan TM Ultra from Applied Biosystems by Life Technologies, Carlsbad, California [24,25]. The DNA was quantified using a nanodrop 2000c UV-Vis Spectrophotometer.

PCR and sequencing

PCR was done using a MJ Mini TM Personal Thermal Cycler from Bio-Rad. Amplification was done as follows: (1 cycle for 1 min at 95°C, 35 cycles of 45 sec at 94°C, 45 sec at 50°C, 45 sec for extension at 72°C; 1 cycle of final extension for 5 min at 72°C). Primers 729+(5’AGCTCGAGAGAGATCTCTGA3’, bases 788,925–788,944) and 729-(5’CTGCAATGTTCTGCGTGGAA3’, complement of bases 789,634–789,653), that are specific for B. cinerea, were used for amplification [26]. These primers amplify a region on chromosome 13 (bases 788,945–789,633), which is a part of the complete genome sequence of B. cinerea B05.10 (http://www.ncbi.nlm.nih.gov/ bioproject/PRJNA264284 ). A single band of 0.7 kb that is specific to B. cinerea was amplified in our isolates. We also used a second set of primers: BC108+(5’-ACCCGCACCTAATTCGTCAAC-3’, bases 789,015–789,035) and BC563–(5’ GGGTCTTCGATACGGGAGAA-3’, complement of bases 789,470–789,489). These new primers were used to amplify a DNA fragment of 0.48 kb to 0.36 kb in case there is a possible deletion of 0.12 kb that could not be detected with the primers C729+/– [27]. Upon verification of desired band sizes through gel electrophoresis, the PCR products were purified using the USB®EXOSAP-IT® reagent (USB Corporation, Cleveland Ohio) [28]. The purified PCR products were sequenced at UC Davis sequencing facility. Nucleotide sequences (bases 789,012 to 789,488 of chromosome 13) were analyzed and aligned using Vector NTi software version 8 (Life Technologies, Pleasanton, California).

Sequence analysis

The 476 bases (bases 789,012 to 789,488 of chromosome 13) and 688 bases (bases 788,945 to 789,633 of chromosome 13), which were sequenced and aligned to each other for analysis, are too small for accurate phylogenetic analysis. These gene regions contain a few polymorphic sites that are useful for distinguishing several genotypes. Thus, they are also useful for estimating population diversity on chromosome 13 among the isolates. We used the Highlighter tool to compress the sequence information into a figure that illustrates the diversity (Figure 1). (http://www.hiv.lanl.gov/content/sequence/ HIGHLIGHT/HIGHLIGHT_XYPLOT/highlighter.html ).

plant-pathology-microbiology-wild-type-isolates

Figure 1: Graphical representation of mutant versus wild type isolates.

Pathogenicity assay

Isolates were grown on PDA plates at 27°C. Plugs (0.6 cm diameter) of developed hyphae were placed in the center of a PDA plate. The plates were grown for 21 days.

To produce inoculum, the spores were washed from the plates with 4 ml KH2PO4- glucose solution, filtered with 50 l m-mesh sieves, and adjusted to a concentration of 107 conidia mL_1 using Bright-Line haemocytometer (Cambridge Instruments Inc. USA) [3,29]. Before inoculation, the spore suspensions were vortexed thoroughly to ensure the homogeneous dispersal of conidia in the solution.

Whole Fragaria ananassa, the common field strawberry, were obtained commercially and used for inoculation. Uniform and undamaged strawberries were selected for experimentation. The fruits were surface-sterilized with 2% sodium hypochlorite (NaClO) for a period of 2 min, rinsed with sterile water, and then air dried on a clean bench for approximately 1 h [3]. Once dried, the fruits were injected with the inoculum (approximately 1-2 mm in depth) at the strawberry’s equator with a sterile syringe [30]. The fruits were also inoculated with double distilled H2O as a negative control.

Inoculations were done in egg cartons. The cartons were placed in a cardboard box and incubated at 20°C for 6 days. The egg cartons were randomized and their positions changed within the cardboard box. The fruits were monitored for lesion size every 12 h for a period of 5 days.

Results

Surveys

The host range and geographic distribution of B.cinerea in California are summarized in Table 1. There were 79 isolates collected from various locations in California and 63 of those isolates were sequenced. Agricultural crop hosts in this study on which B. cinerea were identified included: strawberry (F. ananassa) collected from Oxnard, Watsonville, Salinas, and Tule Lake; blackberry (Rubus fruticosus) from Watsonville; and raspberry (Rubus idaeus) from Oxnard and Watsonville. There were a total of 66 isolates collected from strawberries, 12 isolates collected from raspberries, and 1 from blackberry. B. cinerea samples were collected from infected areas of raspberry and strawberry crops. B. cinerea was collected from leaf petiole in the blackberry sample.

Morphology-pattern of growth

Various kinds of growth patterns were observed on the PDA agar plates at 27°C under light. Mycelia were produced in numerous patterns that displayed powdery, cottony, and radial characteristics (Figure 2). The colonies were varied, from white, dirty white or grayish in color to reddish, brown and black. Many displayed a hyaline pattern in the middle but as it dispersed it became light gray to dark brown. The pattern of growth was similar to the observations recorded by others [31].

plant-pathology-microbiology-Morphological-diversity

Figure 2: Morphological diversity of Botrytis.

Microscopy

Studies were conducted to measure the length and width of the conidia in the 79 studied isolates. We observed larger conidia sizes in the mutant isolates, identified through genomic studies, using sequencing analysis (Table 2) [32,33]. The larger conidia size was observed only in those mutant lines that had 4 nucleotide insertions (Table 3). However, isolates 04, 16, 59, 61, 63, and 74, which only had single nucleotide polymorphisms (SNPs), showed smaller/similar conidia size compared to the non-mutant lines. A t-test of unequal variance on the length and width of the conidia was done to show the significance of the size of the conidia for possible mutant isolates compared to the non-mutant isolates; p-values were < 0.05 for length and width of the conidia. Results showed a p–value of (5.33 × 10-6) for length and (9.33 × 10-6) for width (Figures 1A and 1B). Thus, the size of mutant conidia with a 4-nucleotide addition was significantly larger than the non-mutant lines; this can be seen in the graph (Figures 3A-3C). Conidia with SNPs did not show significant difference when compared with wild type isolates (Figures 3D and 3E).

Spore Width (um) Spore Length (um)
Isolate number Replicate 1 Replicate 2 Replicate 3        Mean Standard Error Replicate 1 Replicate 2 Replicate 3 Mean Standard  Error          
BOT01 5 5.1 5.12 5.07 0.037 6 5.8 5.99 5.93 0.065
BOT02 5 5.2 5.11 5.1 0.058 6.14 6.1 6.2 6.15 0.029
BOT03 5 5 5 5 0 6.14 6.14 6.26 6.18 0.04
BOT04 4.71 4.7 4.74 4.72 0.012 6.86 6.82 6.65 6.78 0.064
BOT05 5 5.16 5.2 5.12 0.061 6.43 6.3 6.5 6.41 0.059
BOT06 4.71 4.69 4.68 4.69 0.0088 6.43 6.21 6.51 6.38 0.09
BOT07 5 5.1 5 5.03 0.033 5 4.97 5.2 5.06 0.072
BOT08 4.71 4.72 4.64 4.69 0.025 6.43 6.22 6.25 6.3 0.066
BOT09 5 5.3 5.2 5.17 0.088 6.43 6.43 6.49 6.45 0.02
BOT10 5 5.16 5.23 5.13 0.068 7.14 7.15 6.92 7.07 0.075
BOT11 4.71 4.66 4.69 4.69 0.015 5.71 5.66 5.55 5.64 0.047
BOT12 4.43 4.39 4.41 4.41 0.012 6.43 6.22 6.35 6.33 0.061
BOT13 5 5.11 5.16 5.09 0.047 6.43 6.7 6.55 6.56 0.078
BOT14 4.28 4.3 4.24 4.27 0.018 6.43 6.2 6.34 6.32 0.067
BOT15 4.43 4.41 4.42 4.42 0.0058 5.86 6 5.7 5.85 0.087
BOT16 5 4.9 5.2 5.03 0.088 5 5.23 5.13 5.12 0.067
BOT17 5 5.1 5 5.03 0.033 6.43 6.24 6.51 6.39 0.08
BOT18 4.71 4.71 4.83 4.75 0.04 6.14 6 6.2 6.11 0.059
BOT19 4.71 4.72 4.63 4.69 0.028 6.43 6.31 6.23 6.32 0.058
BOT20 5 5.18 5.2 5.13 0.064 6.43 6.59 6.55 6.52 0.048
BOT21 5 5.2 5.26 5.15 0.079 5 5.2 5.1 5.1 0.058
BOT22 5 5.01 5.14 5.05 0.045 5 5 5 5 0
BOT23 4.28 4.3 4.28 4.29 0.007 6.43 6.21 6.2 6.28 0.075
BOT24 5 5.1 4.9 5 0.058 6.13 6.31 6.13 6.19 0.06
BOT25 5 5.2 5.12 5.1 0.058 6.14 6 6.26 6.13 0.075
BOT26 5 5.1 5.1 5.07 0.033 6 6.19 6.12 6.1 0.055
BOT27 5.86 5.89 5.83 5.86 0.017 7.43 7.38 7.25 6.35 0.054
BOT28 5 5 5 5 0 5.9 6 5.99 5.96 0.032
BOT29 5.67 5.6 5.4 5.56 0.081 7.86 7.73 7.7 7.76 0.049
BOT30 7.86 7.9 7.86 7.87 0.013 8.57 8.65 8.56 8.59 0.028
BOT31 4.71 4.7 4.9 4.77 0.065 5 5.3 5.22 5.17 0.09
BOT32 4.43 4.4 4.23 4.35 0.062 5.28 5.25 5.2 5.24 0.023
BOT33 6.43 6.39 6.25 6.35 0.055 11 10.8 11.1 11 0.086
BOT34 4.71 4.69 4.88 4.76 0.06 6.14 6.8 6.5 6.48 0.19
BOT35 8.57 8.68 8.88 8.71 0.091 9.28 9.25 9.36 9.3 0.033
BOT36 5 5.1 5 5.03 0.033 5.71 5.63 5.8 5.71 0.049
BOT37 5.2 5.12 5 5.11 0.058 6.14 6 6.3 6.15 0.087
BOT38 5.2 5.14 5.16 5.17 0.018 6.43 6.4 6.58 6.47 0.056
BOT39 7.86 7.9 8 7.92 0.042 10 9.89 10.2 10 0.091
BOT40 5.2 5.18 5 5.13 0.064 6.57 6.5 6.6 6.56 0.03
BOT41 5.1 5 5.2 5.1 0.056 5.71 5.41 5.6 5.57 0.088
BOT42 5.89 5.82 5.86 5.86 0.02 7.14 7.26 7.3 7.23 0.048
BOT43 4 4.9 4.89 4.6 0.3 6.43 6.23 6.35 6.34 0.058
BOT44 5 5.89 5.1 5.33 0.28 7.14 7 7.21 7.12 0.062
BOT45 5 4.87 5 4.96 0.043 5.96 6 5.9 5.95 0.029
BOT46 5 4.9 5.1 5 0.058 6.43 6.16 6.16 6.25 0.09
BOT47 5 5.1 5.3 5.13 0.088 6.23 6.2 6.23 6.22 0.01
BOT48 5 5.2 5.2 5.13 0.067 6 6 6.11 6.04 0.037
BOT49 8.57 8.68 8.64 8.63 0.032 9.28 9.23 9 9.17 0.086
BOT50 4.98 5.19 5.19 5.12 0.07 6.43 6.4 6.5 6.44 0.03
BOT51 5.43 5.39 5.58 5.47 0.058 7 7 7.2 7.07 0.067
BOT52 0 0 0 0 0 6.76 6.7 6.72 6.73 0.018
BOT53 5.43 5.49 5.5 5.47 0.022 7.86 7.73 7.59 7.73 0.078
BOT54 5 5.2 5 5.07 0.067 5.42 5.86 5.8 5.69 0.14
BOT55 5 5.1 5.3 5.13 0.088 5 5.02 5 5.01 0.0067
BOT56 5 4.9 5.16 5.02 0.076 6.29 6.3 6.3 6.3 0.0033
BOT57 5 4.96 5.21 5.06 0.078 6.43 6.4 6.21 6.35 0.069
BOT58 5 4.89 5.1 5 0.061 6.43 6.12 6.25 6.27 0.09
BOT59 5 5.1 5.3 5.13 0.088 5 5 5.3 5.1 0.1
BOT60 0 0 0 0 0 0 0 0 0 0
BOT61 5 5.23 5 5.08 0.077 6.43 6.23 6.42 6.36 0.065
BOT62 5 5.11 5 5.04 0.037 6.86 6.89 7 6.92 0.043
BOT63 5 5.29 5.14 5.14 0.083 6.43 6.42 6.59 6.48 0.055
BOT64 4.43 5.39 4.58 4.8 0.3 6 6.02 6.23 6.08 0.074
BOT65 5 4.2 4.9 4.7 0.25 6.43 6.2 6.28 6.3 0.067
BOT66 5 4.8 5 4.93 0.067 6.23 6.2 6.23 6.22 0.01
BOT67 5.89 5.9 5.9 5.9 0.003 6.89 6.86 6.86 6.87 0.01
BOT68 8.57 8.2 8.5 8.42 0.11 10.7 10.8 10.8 10.8 0.03
BOT69 4.71 4.65 4.6 4.65 0.032 6.43 6.59 6.52 6.51 0.046
BOT70 5 4.89 5.1 5 0.061 6.14 6.1 6.11 6.11 0.012
BOT71 5 4.99 4.85 4.95 0.048 6.14 6.3 6.16 6.2 0.05
BOT72 5 5.29 5.39 5.23 0.12 7.86 7.88 7.85 7.86 0.0088
BOT73 4.43 4.49 4.5 4.47 0.022 6.3 6.28 6.24 6.27 0.018
BOT74 5 4.96 5.12 5.03 0.048 5 5 5 5 0
BOT75 4.9 4.97 5.09 4.99 0.055 7 6.42 6.42 6.61 0.19
BOT76 5.71 5.65 5.6 5.65 0.032 7.14 7.14 7.19 7.16 0.017
BOT77 8.57 8.6 8.7 8.62 0.039 9.28 9.2 9.3 9.26 0.031
BOT78 5 5 4.8 4.93 0.067 6.43 6.2 6.35 6.33 0.067
OT79 5.2 5.2 5.1 5.17 0.033 6.14 6 6.1 6.08 0.042

Table 2: Measurements of width and length of conidial spores found in each isolate.

plant-pathology-microbiology-Virulence-pattern

Figure 3: Virulence pattern of wild type and mutant isolates of B. cinerea.

PCR amplification

PCR primers amplified a 0.7 kb intergenic sequence unique to B. cinerea [26]. A secondary set of primers amplified an internal region of the 720 bp, identified by C729+/- primer sets in order to identify all strains as B. cinerea. Because of the specificity of primer C729 +/- [26], we were able to get PCR bands for all our 79 samples. We were also able to obtain sequencing results for 65 samples. However, since it was reported that C729+/- primers were not able to identify some of the Botrytis species due to a deletion [27], we also used another set of primers: BC108/563 [26]. This was done in an effort to make sure that all our desired products would be identified correctly. Both sets of primers were also used to for each of the 79 samples to assure accuracy. Using the two sets of primers successfully amplified all of the samples, but it was impossible to sequence all of the samples. A possible explanation for 14 samples not having sequencing information is, a PCR reaction is exponential and therefore amplification can go beyond the linear part of the reaction, meaning if we had inefficient primers it will produce products similar to those of very efficient primers. However, sequencing is linear. Therefore, inefficient primers can produce weak or undetectable bands, which might have been the reason for the 14 samples with no sequencing information. Thus, inefficient primers can lead to failed sequencing although the PCR reaction was a success.

Sequence analysis

A total of sixteen (Table 3) of our isolate sequences shared the same 4-base insertion (GGGA at columns 282-285), which was also shared by the Botrytis identified from Gladiolus sp. of India. The 4-base insertion was seen in twelve of the isolates (27, 29, 30, 33, 35, 42, 44, 49, 51, 53, 68, and 72 when using both the BC108/563 and the C729+/- primers. Three isolates 67, 76, and 77 showed the 4-base insertion only when sequenced using the BC108/563 primers. Isolate 39 showed the 4-base insertion only when sequenced using the C729+/- primer (Table 3) (Figures 4A and 4B). Microscopic studies showed that each of the sixteen mutants shared identical phenotypic changes. The highlighter plot (Figures 4A and 4B) shows that there is as much variability within the population of Botrytis sampled in Californian strawberry fields, as there is between isolates collected in other areas of the world. For example, the 4-base insertion GGGA columns 282-285 in our alignment is shared with an isolate found on Gladiolus flowers from India with Gene Bank accession number KP141796 (as yet unpublished). The authors who submitted this isolate have yet to publish their phenotypic findings, thus we have yet to see if the 4 bp insertion corresponds with increased virulence in the Indian isolate of Gladiolus. The majority of our isolates had the same 4 single-base differences from the complete genome sequence (http://www.ncbi.nlm.nih.gov/bioproject/PRJNA264284 chromosome 13) used as the “MASTER” or reference sequence for this figure.

Isolate number Cultivar Type of infection Isolate origin  Primers C729+/- Primers BC108+/563- Type of mutation
BOT01 strawberry postharvest Oxnard (-) na  
BOT02 strawberry postharvest Oxnard na na  
BOT03 strawberry postharvest Oxnard na na  
BOT04 strawberry postharvest Oxnard (+) na Single bp change  (T-->C)
BOT05 strawberry postharvest Oxnard (-) na  
BOT06 strawberry postharvest Oxnard na na  
BOT07 strawberry postharvest Oxnard (-) (-)  
BOT08 strawberry postharvest Oxnard (-) (-)  
BOT09 strawberry, El Dorado field Oxnard (-) (-)  
BOT10 strawberry, El Dorado field Oxnard na na  
BOT11 strawberry, El Dorado field Oxnard (-) na  
BOT12 strawberry, El Dorado field Oxnard (-) (-)  
BOT13 strawberry, El Dorado field Oxnard (-) (-)  
BOT14 strawberry, El Dorado field Oxnard (-) (-)  
BOT15 strawberry, El Dorado field Oxnard (-) (-)  
BOT16 strawberry, El Dorado field Oxnard (+) (+) Single bp change (G-->A)
BOT17 strawberry, El Dorado field Oxnard (-) (-)  
BOT18 strawberry, El Dorado field Oxnard (-) (-)  
BOT19 strawberry, El Dorado field Oxnard (-) (-)  
BOT20 strawberry, El Dorado field Oxnard (-) na  
BOT21 strawberry, El Dorado field Oxnard na na  
BOT22 strawberry, El Dorado field Oxnard (-) (-)  
BOT23 strawberry, El Dorado field Oxnard (-) (-)  
BOT24 strawberry, El Dorado field Oxnard (-) (-)  
BOT25 strawberry, El Dorado field Oxnard na na  
BOT26 strawberry, El Dorado field Oxnard (-) (-)  
BOT27 strawberry, El Dorado field Oxnard (+) (+) 4 nucleotide insertion (GGGA)
BOT28 strawberry, El Dorado field Oxnard (-) na  
BOT29 strawberry, El Dorado field Oxnard (+) (+) 4 nucleotide insertion (GGGA)
BOT30 strawberry, El Dorado field Oxnard (+) (+) 4 nucleotide insertion (GGGA)
BOT31 strawberry, El Dorado field Oxnard (-) (-)  
BOT32 strawberry, El Dorado field Oxnard (-) (-)  
BOT33 strawberry, El Dorado field Oxnard (+) (+) 4 nucleotide insertion (GGGA)
BOT34 strawberry, El Dorado field Oxnard (-) na  
BOT35 strawberry, El Dorado field Oxnard (+) (+) 4 nucleotide insertion (GGGA)
BPT36 strawberry, El Dorado field Oxnard (-) (-)  
BOT37 strawberry, El Dorado field Oxnard (-) (-)  
BOT38 strawberry, El Dorado field Oxnard (-) (-)  
BOT39 raspberry, Pacifica field Watsonville (+) na 4 nucleotide insertion (GGGA)
BOT40 raspberry, Pacifica field Watsonville (-) (-)  
BOT41 raspberry, Pacifica field Watsonville (-) (-)  
BOT42 raspberry, Pacifica field Watsonville (+) (+) 4 nucleotide insertion (GGGA)
BOT43 raspberry, Pacifica field Watsonville na na  
BOT44 raspberry, Pacifica field Watsonville (+) (+) 4 nucleotide insertion (GGGA)
BOT45 raspberry, Pacifica field Watsonville (-) (-)  
BOT46 raspberry, Pacifica field Watsonville (-) na  
BOT47 raspberry, Pacifica field Watsonville (-) (-)  
BOT48 raspberry, Pacifica field Watsonville (-) na  
BOT49 raspberry, Pacifica field Watsonville (+) (+) 4 nucleotide insertion(GGGA)
BOT50 strawberry field Salinas (-) (-)  
BOT51 strawberry field Watsonville (+) (+) 4 nucleotide insertion (GGGA)
BOT52 strawberry field Salinas (-) (-)  
BOT53 strawberry field Salinas (+) (+) 4 nucleotide insertion (GGGA)
BOT54 strawberry field Salinas (-) (-)  
BOT55 strawberry field Salinas (-) (-)  
BOT56 strawberry field Salinas (-) (-)  
BOT57 strawberry field Watsonville na na  
BOT58 strawberry field Salinas na na  
BOT59 strawberry field Salinas na (+) SNP (1) AàG
BOT60 strawberry field Salinas na na  
BOT61 strawberry field Salinas (-) (+) SNP (3) GàA
BOT62 strawberry field Salinas (-) (-)  
BOT63 strawberry field Salinas (+) (-) SNP (2) TàC; AàG
BOT64 strawberry field Watsonville (-) (-)  
BOT65 strawberry field Watsonville (-) na  
BOT66 strawberry field Watsonville na na  
BOT67 strawberry field Watsonville na (+) 4 nucleotide insertion (GGGA)
BOT68 strawberry field Salinas (+) (+) 4 nucleotide insertion (GGGA)
BOT69 strawberry field Watsonville na na  
BOT70 strawberry field Watsonville na na  
BOT71 strawberry field Salinas (-) na  
BOT72 strawberry field Salinas (+) na 4 nucleotide insertion (GGGA)
BOT73 strawberry field Watsonville na na  
BOT74 strawberry field Watsonville (+) (-) SNP (3) CàT; CàT; AàG
BOT75 strawberry field Watsonville na (-)  
BOT76 strawberry field Watsonville na (+) 4 nucleotide insertion (GGGA)
BOT77 strawberry field Watsonville na (+) 4 nucleotide insertion (GGGA)
BOT78 Blackberry   Watsonville (-) (-)  
   BOT79 Strawberry Nursery Tule Lake na na  

Table 3: List of all isolates and primers used to determine mutation in sequencing.

plant-pathology-microbiology-Nucleotide-sequence

Figure 4: Nucleotide sequence comparison using highlighter plot.

Pathogenicity

To evaluate the virulence of different B. cinerea, artificial inoculation experiments with the strawberry (F. ananassa) was done. Disease symptoms were always greater after inoculation of mutant isolates with 4 nucleotide insertion compared to the wild type and mutant isolates with SNPs in all our three replicates (Figures 3A, 3B, and 3C).

Surprisingly, individual fruits of the negative controls also showed slight disease symptoms 4 days after inoculation. It is to be noted here that B. cinerea (grey mold) appears on the surface of a strawberry fruit, only when the fruiting body of the pathogen is visible. However, it is to be noted that the fungus spreads quickly and can exist in a nonfruiting stage in the fruit (non-visible stage). It is quite possible that the strawberries selected for analysis may have the pathogen in the non-fruiting stage. Therefore, we made sure our control fruits, and the other fruits, went through the same sterilization technique to maintain uniformity. The graph indicated that the infection rate was three times higher than the wild type isolates, and five times higher than the negative control (Figures 3B and 3C).

Discussion

Considering the importance of B. cinerea and its significant damage to a wide variety of crops, its control management is necessary. The first step to manage this pathogen is to identify it [27]. Identification has traditionally been dependent on morphological and cultural characteristics coupled with host specificity [34]. Morphological characteristics are often influenced by environmental conditions, which are variable and therefore do not always provide accurate information [35]. The taxonomy of Botrytis species has been used to show how cultural conditions could considerably modify taxonomic characters such as dimension and shape of conidia [35]. Conidia size, form, and colony characters are temperature and media dependent and are often reversible [27,36]. Therefore, to eliminate variability, the use of molecular markers is a good alternative for identification [32]. Species-specific primers that had been used in B. cinerea detection [26] revealed a 4-nucleotide insertion and a single base pair substitution in sixteen isolates. Of the sixteen isolates, the isolates 67, 76, and 77 revealed the 4-nucleotide insertion only when using the BC108/563 primers. This is possibly because of a deletion that could not be detected by the C729+/- primers, as described previously [26]. However, the 4-nucleotide insertion for isolate 39 was only detected using C729+/- primers. This could be because of a failed sequencing reaction. From our experimental findings, we observed that these possible mutated isolates have a larger conidia size when compared to the wild type isolates in our study (Table 2). Virulence, as observed by lesion size on strawberries, was also significantly higher when these isolates were used to inoculate strawberries in the laboratory (Figures 3B and 3C). The question is, does mutation cause a change in conidia size and does this affect virulence? If so, is the mutation responsible for genetic diversity? Does this genetic diversity make epidemiology of the fungus difficult? Mutation is a change in the DNA at a particular locus in an organism. It is the ultimate source of new alleles in plant pathogen populations. It also is the source of new alleles that create new genotypes (such as new pathotypes) within clonal lineages. Small populations have fewer alleles. This is due to genetic drift, and due to fewer mutations generated in small populations. Old populations have more neutral alleles than new populations [16]. Therefore, the center of gene diversity for a species is most often the center of origin for a species. Plants and pathogens have coevolved for the longest time, leading to selection for a diversity of resistance alleles in the plant population [36]. This is why plant breeders seek resistant germplasm at centers of diversity. If the pathogen coevolved with its plant host at the center of origin, we predict that the pathogen population will also exhibit maximum diversity at the center of origin.

Mutation plays an important role in evolution. The ultimate source of all genetic variation is mutation. Mutation is an important first step of evolution because it creates a new DNA sequence for a particular gene, creating a new allele [37]. Recombination can also create a new DNA sequence (a new allele) for a specific gene through intragenic recombination [38]. Mutation acting as an evolutionary force by itself has the potential to cause significant changes in allele frequencies over very long periods of time. But, if mutation were the only force acting on pathogen populations, then evolution would occur at a rate that we could not observe [39,40].

In plant pathology, we are most often concerned with mutations that affect pathogen virulence, sensitivity to fungicides, or sensitivity to antibiotics. In pathogens that show a gene-for-gene interaction with plants, we are especially interested in the mutation from non-virulence to virulence, because this is the mutation that leads to pathogenicity [18,41]. Having that said, mutations from fungicide sensitivity to fungicide resistance are also important in agroecosystems, as are any mutations that affect fitness [42,43].

The marker we sequenced on chromosome 13 is not noted to be closely linked to any pathogenicity genes, so we have no explanation for why strains with one genotype at this locus would be extra pathogenic. The NEP2 pathogenicity gene is on chromosome 2, and the Gluconurodase pathogenicity gene is on chromosome 14.

Why are larger conidia more virulent? In a similar study on a zygomycetes fungus, it was reported that the short or absent isotropic growth period for larger spores, compared to the long phase observed prior to germ tube emergence for smaller spores, could be involved in the differences in virulence [23]. The larger spores are likely poised to undergo rapid invasive hyphal growth compared to the smaller spores. The extended isotropic growth phase of the smaller spores [27,44] results in slow germ tube formation, a block, or a delay in germ tube emergence, and could reduce virulence in the host. The response of macrophages to spores further supported their hypothesis, where larger spores engulfed by macrophages were still able to send germ tubes [45]. In a recent study, it was observed that the mutation of a Botrytis gene has altered the size of conidia and altered virulence [44]. Since we were not able to see similar results in our wild type isolates, we can conclude that the mutation can be considered as a possible reason for larger conidia size and virulence. It has also been reported that the larger conidia are usually fungicide resistant, have a greater life span, and are more virulent in Botrytis [46]. Since there is currently no efficient alternative to control Botrytis, the fungal pathogen is recognized by the Fungicide Resistance Action Committee (FRAC) as a pathogen at high risk of fungicide resistance development. The risk of resistance is also due to numerous characteristics including: large population size, long distance dissemination of conidia by air currents, high genetic variability, the ability to reproduce sexually and asexually, abundant sporulation, polycyclic disease cycle, and wide host range [29]. The development of resistance threatens high yields and crop quality. Thus, it is a serious issue for growers, scientists, and manufacturers. It not only reduces growers’ and manufacturers’ income, but it also has consequences for the environment and human health [46]. Therefore, using a genomic approach to identify diversity [47] within the fungal species, then connecting that diversity to morphological variation and virulence, will provide the initial knowledge needed to better understand the pathogen. This initial knowledge on the pathogenicity factors is essential for fungal infections and is very important because it gives researchers targets in the fight against this pathogen [48].

The isolates with larger conidia had an identical 4-nucleotide insertion, and were observed both in strawberries and raspberries (Tables 2 and 3). Based on the available information of fungicide resistance in B. cinerea, we can possibly assume that the mutation was a result of fungicide resistance [17]. There is also evidence for longdistance migration of mutant strains of pathogens [17].

Conclusion

Our findings have provided valuable genotypic and phenotypic information on the B. cinerea field isolates. We were able to provide information on the pathogenicity of these field isolates subjected to several fungicides not known in a laboratory setting. It is well known that application of fungicides can result in mutations in a pathogen and therefore contribute to resistance. The genotypic results obtained in our study can therefore be used for obtaining basic knowledge on fungicide resistance of this pathogen, and can also indicate appropriate resistance management strategies to ensure continued effectiveness for Botrytis control. In addition, we have identified a genetic marker for detection of Botrytis across a wide variety of plant species.

Sequence Submission

Sequence data from this article have been deposited with the NCBI gene bank under accession numbers: KU145342-KU145392, KX772771-KX772776, KX781161-KX781167.

Conflict of Interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

Author Contribution

J.RE. was responsible for sequence analysis, submission of sequences to NCBI gene bank, PCR, and manuscript preparation and submission. B.F. created the highlighter plot in Figure 1 and with bioinformatics software identified homology of the pathogen sequence in other plant species. S.P. performed microscopy analysis on all isolates used in this study. J.T. created Figure 3A and assisted with sequence analysis and inoculation. P.R.F. created Figures 3B, 3C and 3D, designed and conducted inoculation experiments. C.F. assisted with DNA extraction and PCR. K.S. edited and organized the manuscript and figures for manuscript submission. M.R.C. supervised the research project, wrote the first draft of the manuscript, designed experiments, and assisted with sequence analysis and submission.

Acknowledgments

We express our appreciation to Janet Broome and Mansun Kong at Driscoll’s Strawberry Associates, Watsonville, CA for providing us with the fungal isolates. Table 1 in the manuscript was provided by Janet Broome, Driscoll’s Strawberry Associates, Watsonville, CA. Thanks to Alison Frye and Jackie Hayes for assisting with PCR and microscopy. Thanks to Tanner Harding, Evan Harrison, Branden Robinson and Benjamin Cundick for uploading some of the sequences to NCBI and editing the first draft of the manuscript. Funding for this research was provided in part by Dr. Doug Gubler at UC Davis for funding our sequencing analysis at UC Davis Sequencing facility. The publication was made possible in part by the INBRE program, NIH grant No.P20 GM103408 (National Institute of General Medical Sciences) and SBOE/ISU funds for STEM undergraduate research project No. AHRC38.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 311
  • [From(publication date):
    February-2017 - Apr 30, 2017]
  • Breakdown by view type
  • HTML page views : 272
  • PDF downloads :39
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsonline.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsonline.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsonline.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsonline.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsonline.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsonline.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsonline.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsonline.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsonline.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsonline.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsonline.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsonline.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsonline.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsonline.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsonline.com

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version