alexa Impairment of <em>Nanog3</em> Stem Cell Dysregulation Associate with Male Infertility in Human | OMICS International
ISSN: 2161-1041
Hereditary Genetics: Current Research

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Impairment of Nanog3 Stem Cell Dysregulation Associate with Male Infertility in Human

Saxena AK*, Gupta RK and Rastogi A

Department of Pathology and Laboratory Medicine, Human Cytogenetic and Molecular Genetic Laboratory, All India Institute of Medical Sciences, Phulwarishrif, Patna-801505, Bihar, India

*Corresponding Author:
Ajit Kumar Saxena
Department of Pathology and Laboratory Medicine
Human Cytogenetic and Molecular Genetic Laboratory
All India Institute of Medical Sciences
Phulwarishrif, Patna-801505, Bihar, India
Tel: 9235838943
E-mail: [email protected]

Received Date: December 01, 2014; Accepted Date: March 26, 2015; Published Date: March 29, 2015

Citation: Saxena AK, Gupta RK, Rastogi A (2015) Impairment of Nanog3 Stem Cell Dysregulation Associate with Male Infertility in Human. Hereditary Genet 4:144. doi: 10.4172/2161-1041.1000144

Copyright: © 2015 Saxena AK, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Hereditary Genetics: Current Research

Abstract

Stem cells have capacity to differentiate into a variety of cell types. The inner cell mass of epiblast and primordial germ cells (PGCs) are pluripotent in nature. Nanog3 has been identified as a pluripotent transcription factor belongs to homeobox family of protein required for the survival of primordial germ cell differentiation. Spermatogenesis is associated with highly specialized kind of germ cells (spermatocytes) to form mature single sperm that contribute to the formation of totipotent zygotes any defect in stem cells can lead to infertility. Since, Nanog is a regulatory factor hence the present study has been carried out to evaluate a novel role of Nanog in male infertility and their association with stem cell dysregulations. Blood samples were collected from the patients of azoospermic (absence of sperm) patients and genomic DNA was isolated subjected to PCR based analysis were carried out using specific forward 5’CTGTGATTTGTGGGCCTGA3’ forward and 5’TGTTTGCCTTTGGGACTGGT3’ reverse primers of Nanog3 gene. Interestingly, 8.33% cases revealed a complete disappearance (null) of 151bp length fragment of Nanog (deletion), while 25% overexpression (up regulation) when compared with the normal healthy fertile individuals act as controls. Present study concluded that “mutation” of Nanog3 interfere the process of spermatogenesis either in synergistic manner or with other stem cells (Oct4 or Sox) and increase “risk factor” in male infertility.

Keywords

Stem cells; Azoospermia; Nanog3; Male infertility

Introduction

Infertility is defined as the failure of a couple to become pregnant after one year of regular, unprotected, sexual association. Approximately, 15-20% of all cohabiting couples are affected by infertility during their reproductive lives. Infertility is not "just a female problem" as there is a male infertility component in approximately 50% of couples, suggesting that nearly 7.5 to 10% of all men in the reproductive age group are infertile. Variety of factors that includes infections, injury, sexually transmitted diseases, idiopathiccause, chemotherapy, systemic illnesses, endocrine and familial disorders, genetic and others are associated with infertility. Recent advances have suggested an important role of stem cells in male infertility given its importance in spermatogenesis [1]. Spermatogenesis is a highly complex process where stem cells or spermatogonia, either divide to reproduce themselves for “stem cell” renewal or they divide to produce daughter cells that will later become spermatocytes [2]. Stem cells are responsible for clonogenic proliferation supported by self renewal and differentiation of spermatogonial stem cells (SSCs) during spermatogenesis.

Nanog, a homeodomain containing transcription factor and in combination with Oct4 and Sox2 act as both activator and suppressor of multiple targeted genes responsible for self renewal and differentiation [3]. Although, in human, a verity of stem cell markers have been identified which are required for cell proliferation to maintain pluripotency including Oct4 (octamer-binding transcription factor 4), SRY-related HMG-box (Sox) 2, c-Myc and Nanog [4]. These are gene products and acts as transcription factors essential for selfrenewal of undifferentiated embryonic stem cells. Nanog3 is a homeobox transcription factor and a key player to maintain pluripotency i.e., the ability of a cell to differentiate into any fetal or adult cell type [5]. Further, studies have suggested that Nanog3 is dispensable for the initial differentiation and reprogramming of germ cells. Although, the mutation of Nanog fails to explain pluripotency and might be the cause of failure of production of sperms during spermatogenesis. Thus, the study of stem cells in infertile patients becomes imperative to understand the correlation between the genetic components (gene regulation) of stem cell and their correlation with testicular dysgenesis.

Materials and Methods

In the present study, blood (3 ml) from the clinically diagnosed male infertile patients and the healthy controls were collected after written consent. The samples were collected in containing EDTA vials (anticoagulant). The inclusion criteria of the patients based on a clinical diagnosis of sperm count present in semen that confirmed azoospermia. A total of n=12 male infertile patients suffering from azoospermia and n=20 fertile male act as controls (confirmed having normal sperm counts and normal children) were included in the study. The age groups of the patients were between 18-34 years of age. The study was approved by the ethicical committee of the Institute. Genomic DNA was isolated from whole blood using a Bioner kit (Korea) and samples were kept at -20°C until further analysis. PCR analysis was performed for the identification and characterization of Nanog using forward 5'-CTGTGATTTGTGGGCCTGAA-3' and reverse-5'-TGTTTGCCTTTGGGACTGGT-3' primers. A total volume of 25 μl containing 50-100 ng DNA, 20 pmol of each primer, 200 μM of each dNTP with Taq buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl), 3.0 mM MgCl2, and 3 U Taq polymerase (New England Biolabs). Cycling conditions were 4 min at 94°C for initial denaturation, 56°C/30s of annealing, followed by a final extension of 35 cycles at 72°C for 5 min. PCR products were characterized on 1.5% agarose gel, stained with ethidium bromide and bands were visualized on the Gel Doc system (SR Biosystem).

Results and Discussion

A role for Nanog gene was studied in male infertile patients as well as healthy controls. The levels of Nanog were studied using specific markers for Nanog gene on the basis of the visualization of bands (gene products), their signal intensity to characterize specific amplicons for over expression (up-regulation), regression (downregulation), and complete disappearance of band (null/deletion). Findings were repeated three times to confirm the genetic diversity (Table 1). Statistical analysis was carried out using the χ2 test for comparison of controls and infertile male patients to determine the level of significance. Our results indicated a significant change in the levels of Nanog among male infertile patients compared to the controls. The complete disappearance (deletion) of band of 151bp of Nanog3 in male infertile patients with a frequency of 8.33%, seems to be quite interesting has not been reported earlier (Figure 1). Furthermore, frequency of up-regulation of Nanog was 25%, whereas down-regulation frequency was 16.66% as compared with the controls. Apparently, our results identifying a dysregulation of Nanog in the samples of azoospermic patients in comparison with the normal healthy controls, suggesting a positive association between stem cell gene mutation and infertility. Because Nanog expressed during embryonic stem (ES) cells and embryonic germ (EG) cells and loss of Nanog results confirmed interference with spermatogenesis. It has been identified that Nanog maintains pluripotency [5], hence the present study indicate that loss of Nanog (null) in infertile patients, may result in loss of pluripotency results down regulation or up regulation. However our findings similar to the research work published by Zaehres et al., [6] suggesting any defect in stem cell either failed to maintain self renewal during differentiating stage or failure of spermatogenesis as observed in 8.33% cases showing complete loss of Nanog3. On the other hand, it has been shown that the overexpression of ESC genes, including Nanog3 suppresses differentiation of ESCs [7]. Thus, upregulation as well as down regulation of Nanog may lead to defect in stem cells (spermatogonia), as a result whole of the spermatogenesis process disorganized leading to infertility. It is interesting to note that Nanog3 gene regulation was highly variable in nature amongst the population of male infertile patients sperm during spermatogenesis [8] suggesting the mimicry of stem cells may be different due to different cell lineage (spermatogenesis) or interaction with other of stem cells such as Sox2 or Oct 4. However it has been confirmed with the present study with other group of study suggested that Nanog3 play an essential role during spermatogenesis [9]. Although, our research group also published similar findings that Nanog3 dyregulation in neural tube defect (NTD) cases and Acute Myeloid Leukemia [10,11]. Present study is small but promising to characterized and identify an important linkage between infertility and stem cell. However, future studies are required by share large sample size in different ethnic group of infertile cases to confirm cellular genetic heterogenity.

hereditary-genetics-Amplified

Figure 1: Amplified PCR product of 151bp of Nanog analyzed on (1.5%) agarose gel visualized after ethidium bromide stained. Lane M-100 bp marker; Lane 6 is showing up regulation (over expression); lane 1 and 5 showing complete disappearance/deletion of band; lane 3 and 4 have down regulation, while lane 2 showing normal appearance of Nanog 3. The present study repeated three times to confirm the appearance of bands with respect to controls.

Markers frequency (%) of stem cell expression
Expression Deletion Up regulation Down regulation
Nanog (%) 8.33 25.00 16.66

Table 1: Frequency of stem cell (Nanog) changes in azoospermic cases.

Conclusion

The exact cause of male infertility is still not clear but it is believed to involve multivariate genetic and epigenetic factors. Study of stem cells in infertile male patient’s gives new enlightenment for therapeutic in regenerative medicine. The variations of Nanog3 in the present study are due to (1) heterogeneous (spermatogenesis) group of cell population, (2) severity of disease, and (3) fail to maintain autopluripotency.

Acknowledgement

Author AKS thankfully acknowledge to the Department of Biotechnology, Ministry of Science and Technology, Government of India, New Delhi for providing financial support (No.BT/ PR14671/MED/12/487/2010).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 11785
  • [From(publication date):
    May-2015 - May 22, 2018]
  • Breakdown by view type
  • HTML page views : 7978
  • PDF downloads : 3807
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7