alexa Increased Expression of PITX2, LEF-1,beta-Catenin in Epithelial Ovarian Cancer | OMICS International
ISSN: 2157-7099
Journal of Cytology & Histology

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Increased Expression of PITX2, LEF-1,beta-Catenin in Epithelial Ovarian Cancer

Huanhuan Guo, Hai Zhu, Shujun Zhao, Min Zhang, Xingshuo Liu, Huihui Han, Meng Cao, Li Dong and Hongyu Li*

Department of Obstetrics and Gynecology, The Third Affiliated Hospital of Zhengzhou University, Zhengzhou, PR China

*Corresponding Author:
Hongyu Li
Department of Obstetrics and
Gynecology The Third Affiliated
Hospital of Zhengzhou University
Zhengzhou, PR China
Tel: 86 15936257242
E-mail: [email protected]

Received date: April 12, 2015; Accepted date: June 11, 2015; Published date: June 13, 2015

Citation: Guo H, Zhu H, Zhao S, Zhang M, Liu X, et al. (2015) Increased Expression of PITX2, LEF-1,β-Catenin in Epithelial Ovarian Cancer. J Cytol Histol 6:333. doi:10.4172/2157-7099.1000333

Copyright: © 2015 Guo H, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Cytology & Histology

Abstract

Objective: Pituitary homeobox-2 (PITX2), a member of the bicoid/paired-like homeobox gene family, plays an important role in determining left-right asymmetry in vertebrates and development of multiple organs by serving as a downstream effector of Nodal, TGFβ, and Wnt signaling pathway. PITX2, lymphoid enhancer factor (LEF-1) and beta-catenin are required for the inductive formation of several epithelial-derived organs, including teeth, which remains unclear interaction Wnt signal pathway in the development of ovarian epithelial tumors. Research PITX2, LEF-1 and beta-catenin direct interactions may provide new mechanisms for epithelial ovarian cancer.
Materials and methods: 1. Using immunohistochemical (IHC), real-time quantitative RT-PCR (Q-PCR), Western blot to analyse the expression of PITX2, LEF-1, β-catenin in ovarian cancer tissues and cell lines. 2. Using Enzymelinked immunosorbent assay (ELISA) to detect the expression of PITX2 in serum of epithelial ovarian cancer. 3. Using MTT to investigate cell’s proliferation and migration.
Results: 1. The protein and mRNA in PITX2, LEF-1, β-catenin frequently overexpress in ovarian cancer samples and cell lines. Low or no expression in benign ovarian tumors and normal ovarian samples (p<0.05). 2. The preoperative serum levels of PITX2 in ovarian cancer groups was higher than benign ovarian tumors and normal ovarian samples (p<0.05), and the levels of PITX2 in preoperative serum in ovarian cancer groups were significantly higher than the postoperative groups (p<0.05).
Conclusion: PITX2 is involved in the occurrence and development of epithelial ovarian cancer, and PITX2 may act as a downstream target genes in the Wnt/β-catenin signaling pathway, which is regulated by Wnt/β-catenin. The high expression of PITX2 protein in the serum of patients with epithelial ovarian cancer, suggesting that PITX2 may serve as a good indicator of early diagnosis and evaluation of disease progression in patients with epithelial ovarian cancer.

Keywords

PITX2; LEF-1; β-catenin; Gene expression; Epithelial ovarian cancer

Introduction

Ovarian cancer is one of the three most common female genital cancers in the world, with its mortality rate highest among the others. About 90% ovarian cancer comes from epithelia. The five years survival rate is still hovering around 25%–30% due to the late diagnosis and poor therapeutic response. Ovarian hidden in the pelvic, epithelial ovarian cancer is poor prognosis, 70%~80% advanced stage, we occurs it easily transfer and diffusion. However, even after complete tumor debulking surgery, the cancer’s recurrence rate is still high. Epithelial ovarian cancer has become a type of serious tumor that threatens women’s lives [1-7]. Early detection and effective suppression of ovarian tumor’s invasion and metastasis, which lead to an increase of the survival rate of patients in the long run, will open up new ideas for the treatment of epithelial ovarian cancer.

PITX2, located on chromosome 4q25-26, is a member of the bicoid homeodomain family, the origin of the function in pituitary development, which plays an important role in embryogenesis, pituitary, eye, teeth and heart of vertebrates. Several studies have reported that mutation of PITX2 is associated with the pathogenesis of Axenfeld- Rieger syndrome (ARS), iridogonio dysgenesis syndrome, sporadic Peter syndrome, and so on [8,9]. Previous studies have pointed out that PITX2 is one of the downstream effectors of Wnt/β-catenin pathway and PITX2 may be regulated by canonical b-catenin pathway [10-12]. As we all know, Wnt signaling pathway is playing an important role in the development of ovarian cancer, but the relationship between PITX2 in ovarian cancer remains unclear.

Lymphocyte enhancer factor (LEF1) is located on human chromosome 4q23-25 region, which is a high mobility group (HMG) transcription factor, one of lymphoid enhancer factor/T-cell factor transcription factor family member, was found as lymphoid-specific transcription factors and closely associated with the differentiation of thymocytes.it collaborates with other DNA-binding proteins activates transcription. In recent years, studies have reported that β-catenin can bind the TCF/LEF family of transcription factors, displacing a corepressor and changing them to activators of transcription [4]. LEF-1 is a key nuclear transcription factor in wnt/β-catenin signaling pathway,which abnormalities expression is associated with multiple tumors,such as osteosarcoma[13], breast cancer [14,15], colon cancer [16] and melanoma [17] etc.

In a present study, PITX2 and LEF-1 have specific binding sites in the development of pituitary gland. LEF-1 is a downstream target of PITX2. PITX2 and β-catenin directly interact to regulate LEF-1 expression [4]: when stimulated by wnt signaling pathway, PITX2 transcriptional activity is enhanced; on the contrary, PITX2 cannot transcribe. However, currently, it has not been reported in epithelial ovarian cancer. The present study was to investigate the relationship of PITX2, LEF-1 and b-catenin in the development of epithelial ovarian cancer. When add the DKK1 (wnt signaling pathway inhibitor) in the cells, PITX2 and LEF-1 transcriptional activity are weakened.

Materials and Methods

Clinical samples

Surgical resection of 114 tumor samples from the Third Affiliated Hospital of Zhengzhou University dated from September 2012 to December 2014. The age of the patients were from 16 to 70 years old, with a mean of 49.79 years old. According to the classification of the International Federation of Gynaecology and Obstetrics (FIGO), clinical samples were divided into three groups: 42 cases of epithelial ovarian cancer (the stage of I~II and III~IV is respective 15 and 17 cases), 37 cases of epithelial ovarian benign tumor, and 35 cases of normal ovarian ,All the tissue specimens were fixed in 10% formalin and embedded in paraffin. 114 Blood samples were collected from 6:00 am to 8:00 am. The samples stayed at room temperature for 20 min, and centrifuged by 3000 r/min under 4°C for 20 min, and then finally took Serum samples to the EP tubes, staged in -80°C. 114 cases were not associated with other cancers, preoperative and postoperative were not receiving radiotherapy and chemotherapy, Signature were obtained from all 114 cases, either from the patient or the patient’s family.114 samples confirmed by postoperative pathology diagnosis.

Cell lines

SKOV-3, OVCAR3 (ATCC, Manassas, VA), both were supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 units/ml penicillin, and 100 μg/ml streptomycin (both Invitrogen) in 75 cm2 flasks and incubated at 37°C in 5% CO2 added wnt pathway inhibitor DKK130 ng/ml When the cells into the logarithmic phase. Cell groups: SKOV3 control group, SKOV3+DKK1 inhibitor group, OVCAR3 blank control group, OVCAR3+DKK1 inhibitor group.

Immunohistochemical

114 Ovarian tissue arrays were immunostained with primary rabbit polyclonal anti-PITX2 antibody (1:50 dilution), anti-LEF1 antibody (1:150 dilution) (SantaCruz Biotechnology,Inc., Santa Cruz,CA,USA) and primary rabbit polyclonal anti-β-catenin antibody (1:500 dilution) (AbcamInc,MA,USA). The stained section was identified as positive or negative. Random observation under the microscope 10 high power fields (SP × 400), counting 100 cells per field For those immunopositive samples, the intensity of the staining (+1: faint; +2: moderate; +3: strong; +4: very strong), and the proportion of stained area (0– 100%) were scored. Cancerous tissue staining intensity is ≥ 3. Although staining intensity=2, the percentage of positive cells ≥ 10% are classified as positive. No matter what the positive rate is, cancerous tissue staining intensity ≤ 1, are all negative [7] (Figure 1).

cytology-histology-Immunohistochemical

Figure 1: Immunohistochemical (IHC) analysis of PITX2、LEF-1 and β-catenin expression in ovarian cancer samples, benign ovarian tumors and normal ovarian tissues. (magnification: 400X)

A1: Positive expression of PITX2 in epithelial ovcarian cancer tissues; B1: Negative expression of PITX2 in benign ovarian tumors; C1: Negative expression of PITX2 in normal ovarian tissues; A2: Positive expression of LEF-1 in epithelial ovcarian cancer tissues; B2: Weakly negative expression of LEF-1 in benign ovarian tumors; C2: Negative expression of LEF-1 in normal ovarian tissues; A3: Positive abnormal expression of β-catenin in epithelial ovcarian cancer tissues; B3: Negative expression of β-catenin in benign ovarian tumors; C3: Negative expression of β-catenin in normal ovarian tissues.

ELISA assay

114 Serum samples arrays were in strict operated with the ELISA instructions (Bioss Biological Co.) Each sample was performed triplicate and three independent experiments were carried out. Finally, absorbance of each well were measured at 450 nm wavelength.

Quantitative real time RT-PCR (Q-PCR)

Total RNA from the clinical samples and the cultured cells was isolated using the TRIzol reagent. cDNA was prepared using Reverse transcription reagent kit (Applied Biosystems, Foster City, CA, USA). Relative expression levels of the specific genes were quantified by Q-PCR using power SYBR Green-I kit on the ABI 7500 Real Time PCR system (Applied Biosystems) after normalization with the expression of 18S rRNA genes. 800 ng of total RNA were isolated from tissue and cells, and were reverse-transcribed as mentioned above, followed by Q-PCR.After purification, PCR was used with the following conditions: Predenaturating 95°C for 60 s, annealing at specific temperature for each set of primers 95°C for 15 s, and 65°C for 45 s, for 40 cycles.The information of Primers was mentioned in Table 1.

Gene name Forward primer(5’→3’) Reverse primer(5’→3’) Product size/bp Tm/°C
PITX2 CTCCAGTCTCAACAGCCTGA ATACTGGCAAGCACTCAGGT 226 59.0
LEF-1 AAACCGAAGCGAAAGGGAAG AACGAAACGTCCACTTCCTG 113 58.0
β-catenin TGGGACACAGCAGCAATTTG AGCAGCTGCACAAACAATGG 147 60.0
GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC 258 60.0

Table 1: The primer details.

Western blot analysis

105 cells for SKOV3 and 2 × 105 cells for OVCAR3 seeded in a 6-well plate for 24 h added to the wnt pathway inhibitor DKK130 ng/ml. After 48 h the cells were scraped off by the brush. It was then centrifuged at 1200 Xg for 10 min at 4°C. Collected the supernatant, resolved on 10% SDS-PAGE (25), and subjected to immunoblotting with antibodies including anti-β-catenin (1:500 dilution), anti-active β-catenin (1:550 dilution), anti-LEF-1 (1:500 dilution) anti-PITX2(1:1000 dilution. The experiments were performed three times independently.

Cell proliferation assays

SKOV-3 cells (2 × 103cells/well) and OVCAR-3cells (3 × 103cells/ well) were seeded on a 96-well culture plate. Pretreated cells by DKK1 next day, after 6h, medium was discarded, washed with sterile PBS, the growth rate of cells was assessed by MTT assay kit (solarbio Biological Co). Photometric detected at 490 nm wavelength.

Transwell cell migration

SKOV-3cells (3.4 × 105cells/well) and OVCAR-3 cells (2.5 × 105cells/ well) were seeded on a 6-well culture plate that labeled with marker pen. After 24 h, draw a line in the hole along with a ruler, washed with sterile PBS three times,pretreated cells by DKK1 (30 ng/ml), seeded in an incubator, pictured respectively 0, 6, 12, 24 h .Data analysis and processing by Image J.

Data analysis

Data were presented as mean ± SD. Student’s t-test, Chi-square test or Fisher exact test and ANOVA were used to analysis parametric data. The correlation of PITX2、LEF-1 and β-catenin test were analysed by spearman correlation test. A P-value of <0.05 was considered significant in all experiment.

Results

PITX2, LEF-1 and β-catenin overexpressed in epithelial ovarian cancer tissues

Despite the functions of PITX2, LEF-1 and β-catenin during other cancers have been extensively studied, the functional roles of these proteins in human cancers remain largely unknown. Here, Consistent with the immunohistochemical and Q-PCR findings, we evaluated the expression status of PITX2、LEF-1 and β-catenin in ovarian cancer samples, benign ovarian tumors and normal ovaries. Ovarian cancer cell lines including SKOV-3cells and OVCAR-3 cells. We found PITX2 、LEF-1 and β-catenin were significantly overexpressed in ovarian cancer samples as compared with benign ovarian tumors and normal ovarian tissues (P<0.01) (Table 2). Clinicopathological correlation showed that overexpressed PITX2, LEF-1 and β-catenin were remarkably associated with clinical stage, histological grade and lymph node metastasis (P<0.05). Whether there is lymph node metastasis in ovarian cancer, the datas of LEF-1 and β-catenin were close to the threshold, respectively P=0.045 and P=0.044, so this requires further experiments certification. However, there was no significant association between the overexpressed of PITX2, LEF-1, β-catenin and other parameters such as age and pathological type (P>0.05); the positive expression rate of III-IV stage was significantly higher than I-II stage (P<0.05), the expression of poorly differentiated was significantly higher than the Well differentiated and differentiated. There was no significant association between the Well differentiated and differentiated (Tables 3-5). ELISA data also showed that PITX2 was significantly overexpressed in ovarian cancer serum samples as compared with the serum of benign ovarian tumors and normal ovaries (P<0.05), but benign ovarian tumors and normal ovaries have no significant difference (P>0.05). Development of epithelial ovarian cancer may be associated with abnormal expression of these three genes.

Group n PITX2 LEF-1 β-catenin
+ (%) c2 P-value + (%) c2 P-value + (%) c2 P-value
Cancer group 42 35 (83.33) 51.072 <0.001 32 (76.19) 37.928 <0.001 36 (85.71) 68.462 <0.001
 Benign group 37 6 (16.21)     8 (21.62)     4 (10.81)    
Normal group 35 5 (14.29)     5 (14.29)     2 (5.71)    

Table 2: The expressions of PITX2, LEF-1, β-catenin proteins in different ovarian tissues.

Group n   PITX2     LEF-1     β-catenin  
    +(%) c2 P-value +(%) c2 P-value +(%) c2 P-value
Total 42                  
Age                    
<50 20 16(80) 0.019 0.890 14(70) 0.287 0.592 16(80) 0.322 0.057
>50 22 19(86.36)     18(81.82)     20(90.91)    
Grade                    
G1-G2 13 8(61.54) 4.367 0.037 7(53.85) 5.182 0.023 8(61.54) 4.355 0.012
G3 29 27(93.1)     25(86.21)     28(96.55)    
Stage                    
I + II 15 9(60) 6.720 0.01 8(53.33) 4.903 0.027 10(66.67) 4.706 0.03
III + IV 27 26(96.3)     24(88.89)     26(96.3)    
Lymph node metastasis                    
with 26 25(96.15) 5.836 0.016 23(88.46) 4.029 0.045 25(96.15) 4.043 0.044
without 16 10(62.5)     9(56.25)     11(68.75)    

Table 3: Relations between abnormal expressions of PITX2, LEF-1, β-catenin proteins and clinical pathological features of epithelial ovarian cancer.

Group n PITX2 mRNA LEF-1 mRNA β-catenin mRNA
Cancer group 42 0.286 ± 0.106*# 0.504 ± 0.116*# 0.405 ± 0.126*#
Benign group 37 0.132 ± 0.095Δ 0.241 ± 0.112Δ 0.167 ± 0.106Δ
Normal group 35 0.110 ± 0.082 0.223 ± 0.097 0.128 ± 0.087
F   40.569 82.921 75.414
P   <0.001 <0.001 <0.001

Table 4: The mRNA expressions of PITX2, LEF-1,β-catenin in different ovarian tissues.

Group n PITX2 F  P
Epithelial ovarian cancer group 42 12.18 ± 2.38    
Benign ovarian tumor group 37 7.83 ± 1.9    
Normal ovarian group 35 7.25 ± 2.24 59.66 <0.01

Table 5: The preoperative serum level of PITX2 in epithelial ovarian cancer group, benign ovarian tumor group and normal ovarian group ( χ ± s ng/ml)

DKK1 inhibits cell growth and migration in ovarian cancer cells

Previous studies have shown that DKK1 inhibits the Wnt/bcatenin signaling way; after added DKK1 30 ng/ml, the proliferation and migration of SKOV3 and OVCAR3 were significantly reduced compared to the control group by MTT and cell scratch test (P<0.05) ,however, the SKOV3 cells weakened more obvious compared with OVCAR3 cells (Figures 2A and 2B).

cytology-histology-proliferation-and-migration

Figure 2: (A and B) After added DKK1, the proliferation and migration of SKOV3 and OVCAR3 as compared with their vector control.

DKK1 inhibits the express of PITX2, LEF-1 and β-catenin in ovarian cancer cells

Given that Pitx2 gene Expression was induced by the Wnt/β- Catenin Pathway, there is a certain relationship between the three genes of PITX2、LEF-1 and β-catenin. To test this notion, we selected two cells (skov3 and ovcar3). When the cells turned into logarithmic phase, DKK 130 ng/ml was added. We found out that not only the cells of Proliferation and migration were weakened, but also the mRNA and prorien of PITX2, LEF-1 and β-catenin all decreased respectively compared to their scrambled control (P<0.05). Collectively, these data suggest that there is no wnt pathway, the transcriptional activity of PITX2 is decline (Figures 3A and 3B).

cytology-histology-Western-blot

Figure 3: (A) The mRNA of PITX2、LEF-1 and β-catenin all decreased respectively as compared with their scrambled control, when added the inhibitor of DKK1. (B) Western blot analysis using anti-PITX2 antibody, anti-LEF-1 antibody and anti-β-catenin antibody showed the reduced expressions of PITX2、LEF-1 and β-catenin by the inhibitor of DKK1.

Discussion

PITX2 involved in embryonic development, which has been studied extensively. Recently, there have been increasing reports showing that PITX2 is overexpressed in human cancers such as nonfunctional pituitary adenomas [18], Wilms tumor [19], Breast cancer [20] and node-positive colorectal cancer [21]. However, the functional roles of PITX2 in human cancers such as ovarian cancer remain unknown. Previous studies have pointed out that PITX2 is one of the downstream effectors of Wnt/b-catenin pathway [10-12]. There is no report show any relationship of Wnt/β-catenin signaling, PITX2 and LEF-1 expression in ovarian cancer. Our study showed that both mRNA and protein levels of PITX2 were frequently upregulated in ovarian cancer compared to benign ovarian tumors and normal ovaries using Q-PCR and IHC analyses. It has associated with clinical stage, histological grade and lymph node metastasis, yet there was no significant associated with age and pathological type. The higher the stage is, the high express of PITX2 is. That indicates that PITX2 may play an important role in ovarian cancer. In this study, we firstly demonstrated that PITX2 was frequently upregulated in ovarian cancers serum,, suggesting that it may be associated with tumor cell’s abnormal increased. Thus, screening the express of PITX2 in Patient’s serum will not only help with ovarian cancer early detection and early treatment, but also has great significance for postoperative follow-up of ovarian cancer patients.

malignancies. Recent In addition, previous studies have pointed out that PITX2 is one of the downstream effectors of Wnt/b-catenin pathway, Wnt/β-catenin can regulate the PITX2 promoter [2].The study found that in SKOV3 and OVCAR3 cells, when adding inhibitor DKK1, the expression of protein and mRNA in PITX2,LEF-1 and β-catenin were decreased compared to the control group, . when the expression of PITX2 was decreased, thereby inhibiting the proliferation and differentiation of cells.O was added

In summary, from the tissue and cell level, our findings suggest that PITX2, LEF-1 and β-catenin play important roles in ovarian cancer progression by promoting tumor growth and migration in ovarian cancer. PITX2 is involved in the occurrence and development of epithelial ovarian cancer and PITX2 may act as downstream target genes in the Wnt/β-catenin signaling pathway, which is regulated by Wnt/β-catenin. There may be the same mechanism of action and the pituitary and teeth. If we could find effective drugs for inhibiting tumor growth, this may provide new ideas for epithelial ovarian cancer patients.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

Article Usage

  • Total views: 11961
  • [From(publication date):
    July-2015 - Jun 19, 2018]
  • Breakdown by view type
  • HTML page views : 8177
  • PDF downloads : 3784
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri & Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7