alexa Investigation and Characterization of Biologically Active Compounds Recovered from Kefir (A Probiotic Fermented Milk) | Open Access Journals
ISSN: 2329-8901
Journal of Probiotics & Health
Like us on:
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Investigation and Characterization of Biologically Active Compounds Recovered from Kefir (A Probiotic Fermented Milk)

Sahar Abd El Moghethl,*, Ahmed Osama El-Gendy2, Serageldeen Sultan3 and Khalid A El-Nesr4

1Post Graduate Studies for Advanced Sciences, Beni-Suef University, Beni-Suef, Egypt

2Pharmacy, Microbiology and Immunology Department, Beni-Suef University, BeniSuef, Egypt

3Veterinary Medicine, Virology Division, Department of Microbiology, South Valley University, Qena, Egypt

4Veterinary Medicine, Department of Pathology, Beni-Suef University, Beni-Suef, Egypt

*Corresponding Author:
Sahar Abd El Mogheth
Post Graduate Studies for Advanced Sciences
Beni-Suef University, Beni-Suef, Egypt
Tel: +201020429455
E-mail: [email protected]

Received Date: April 17, 2017 Accepted Date: April 24, 2017 Published Date: April 29, 2017

Citation: Mogheth SAE, El-Gendy AO, Sultan S, El-Nesr KA (2017) Investigation and Characterization of Biologically Active Compounds Recovered from Kefir (A Probiotic Fermented Milk). J Prob Health 5: 173. doi: 10.4172/2329-8901.1000173

Copyright: © 2017 Madani S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Probiotics & Health

Abstract

Fermented milk is considered as a good source of nutrition for many people. One of the most important substances that could be used in milk fermentation is kefir grains. Kefir fermented milk is very important in many health conditions such as bacterial infections, high blood pressure and some hepatic conditions. The aim of this study was to determine the antibacterial activity of kefir fermented milk against some pathogenic microorganisms as Salmonella sp, Escherichia coli, Staphylococcus sp and Candida albicans by using disc diffusion method. The efficacy of kefir fermented milk was investigated as a hepato-protective against CCl4 inducing liver toxicity and as a protective agent against kidney and spleen damages using laboratory animal model. The results revealed that the kefir fermented milk had a potent antibacterial activity against all tested pathogenic isolates and it also showed high significant protection in mice against CCl4 toxicity. In conclusion, kefir milk can be used as an antibacterial supplement and as a protective agent against liver toxicity.

Keywords

Kefir; Antibacterial; Carbon tetrachloride; Liver toxicity; Milk

Introduction

Kefir is gotten from the Turkish word “keif ” which signifies “nice feeling” [1] and the drink started in the Caucasian heaps of Russia [2-4]. Kefir is obtained from the fermentative activity of Kefir grains [5]. It is traditionally fermented in goat skin bags for 24 hours [6]. Kefir contains many of the ingredients that demonstrate biological activity, such as some bacteria and bioactive peptides [7] onsets of activity varied according to the type of kefir and the fermentation time [8]. It is self-carbonated fermented milk with a slightly acidic taste [2]. The beverage is produced from the cow, goat, sheep [3] camel, buffalo or soya milk [4,9] and whole fat, low-fat, skimmed or fat free milk [1]. This difference in the milk type and methods of fermentation affects the amount of grain produced, food composition and flavor of kefir [2]. Kefir grains are considered the most important component in the production of fermented Kefir and can be reused again [10] it contains many types of bacteria addition to protein, yeast, viable microorganisms and polysaccharides [11-13]. Although the kefir drink can be found in many countries, in Egypt the grains are not available commercially and are culturally donated from person to person.

The partial sequencing of the gene coding for 16S rRNA has been used for species identification [14,15]. The fermented milk produced by Kefir grains contains yeast and lactobacilli but lactococci [16-18]. Kefir has many applications in a variety of medical conditions such as; high blood pressure, allergy problems and coronary artery diseases. Also, it enhances the immune system and improves the digestive health [15,19].

The main objective of this study was to investigate the production of biologically active compounds recovered from kefir, (a probiotic fermented milk). Molecular characterization of the microorganisms isolated from kefir by partially sequencing the 16S rRNA gene and Internal Transcribed Spacer region (ITS). To determine the antimicrobial activity of kefir in vitro against some pathogens as; Salmonella sp, Escherichia coli, Staphylococcus sp. and Candida albicans. Also, to evaluate the hepato-protective effect and antioxidant activity of kefir in mice.

Materials and Methods

Characterization of kefir

Kefir grains collected from Egypt, Qena and they were varying in size (0.3 to 3.0 cm in diameter), irregular shape [20,21] as shown in the Figure 1 and white to yellowish-white in color [17-19]. Also, the grains were flexible, softer texture and viscous [12,17,18] and insoluble in water and common solvents. When added to milk, the grains swelled and produced a jellied called Kefiran [22]. Kefir has a pH of an ethanol content of 0.5- 2.0% (v/v), a lactic acid content of 0.8-1.0% (m/v), a carbon dioxide content of 0.08-0.2%(v/v) [23]. The grains were recovered by sieving, mass of grain increased by 6% after the fermentation process and microorganisms found in milk differ from those produced after the fermentation process [15,22] this may be attributed to factors related to the fermentation process such as time, temperature, the type and quantity of milk and the amount of grain added [15,22].

probiotics-health-physical-appearance

Figure 1: The physical appearance of Kefir grains

The preparation and characterization of kefiran

Then grains were separated from the fermented milk by plastic sieve. The kefir fermented for 24 h and 48 h, taking after 7 days security at 4-8°C was attempted by a balanced in vitro by agar diffusion test [24,25]. Kefir grains were started by adding 100 g of grains to 500 ml of purified milk at 25°C in a dark place.

The antimicrobial activity of kefir against microorganisms

The Kefir fermented milk was platted on MRS agar (Oxide) at 25°C/2 days for the growth of lactic acid bacteria and yeast for characterization (Figure 2). Also, a fresh microbial culture of Staphylococcus aureus and Escherichia coli was platted on mannitol salt agar (Oxide) for Staphylococcus, MacConkey (Oxide) for E. coli at 37°C for 24 hr. After that microbial suspensions were performed in buffered peptone water (BPW) (Oxide) at 37°C for 3-6 hr for antimicrobial estimation. After nutrient agar (Oxide) solidification the microbial suspension was dispensed and allows the medium to adsorb the suspension then six agar wells/plate was made by using a steel cylinder with an external diameter of 8 mm and the internal one of 6 mm. A fixed amount of 50 μl, 100 μl and 150 μl of tested kefir solution was distributed to each well. The plates were incubated for 24 h/37°C.

probiotics-health-negative-bacilli

Figure 2: Gram stain showing gram negative bacilli and yeast recovered from Kefir.

As antibiotic controls there were utilized 10 mg/ml of ampicillin. Affix measure of 50 μl of tried kefir and antimicrobial arrangement was appropriated to each well. The plates were brooded for 24 h, at 30 - 35°C (for bacterial strains) and at 20-25°C (for C. albicans), the breadths of developed clear zones being measured from that point utilizing an advanced gage (Figure 3). The force of the antimicrobial action was translated by correlation with control antibiotic (ampicillin).

probiotics-health-recovered

Figure 3: Gram stain showing gram negative bacilli and yeast recovered from Kefir.

Kefir microbiota identification by partially sequencing the 16S rRNA

The oligonucleotide primers used in 16S rRNA gene sequencing were designed with the online program primer 3, ordered through http://www.invitrogen.com, delivered by Invitrogen and the primer pairs used in PCR reactions shown in the Table 1. The sequencing was carried out using Big Dye® terminator v3.1 cycle sequencing Kit and ABI Prism TM 377 DNA sequencer (Applied Biosystems). The PCR was performed in 200 μl epindorff tube contains PCR buffer, dNTPs mixture, forward primer, reverse primer, Genomic DNA and polymerase enzyme, using PCR program with 34 cycles. Purification of the PCR products using QIAquick spin column according to the manufacturer instructions. Measuring DNA concentration and purity was carried out using Nanodrop “ND-100 Spectrophotometer”. The obtained sequences were analyzed using both Bioedit v.7.0.9.0 and CLC sequence analyzer programs. Searching for homology using BLAST tool at NCBI database.

Evaluation the protective ability of kefir against carbon tetrachloride CCl4-induced liver toxicity in mice

Animal grouping and treatment: Three weeks old, clinically healthy, female Swiss albino mice (n=40) weighting 26-30 g was randomly divided into 4 groups (10 mice/group) after 7 days adaptation. They were housed in stainless-steel wire-mesh cages (four in a cage), at 24 ± 2°C temperature, 55% relative humidity and a 12 h light-dark cycle. The animals were provided a normal diet and tap water. The groups were separately treated for as following: Group I, animals were sham-treated with 2 ml/kg distilled water through oral gavage, daily for 4 weeks; this group of animals served as the control. Group II, animals were treated with 1.5 ml/kg body weight (b.w.) CCl4 dissolved in 1.5 ml corn oil through oral gavage, daily for 4 weeks. Group III, animals were treated with 1.5 ml/kg b.w. CCl4+30 ml/kg b.w kefir through oral gavage, daily for 4 weeks. Group IV, animals were treated with 30 ml/ kgb.w. Kefir through oral gavage daily for 4 weeks.

Preparation of fermented kefir to feed animals: The compound was prepared by washing the kefir grains with distilled water and raw milk, after that heated to 90°C for 10 min in a water bath, then cooled to inoculation temperature (25°C) and 10% active kefir grains added. The mixture was placed in a plastic container with screen cloth as a cover and incubated at room temperature for 24-48 hrs. A plastic container is used because the acidity of fermented kefir may degrade metals such as aluminum and iron which could mix with the drink thereby causing harmful effects to the body [26]. After fermentation, kefir grains were sieved by filtration through a plastic sieve and washed for another process [27]. Kefir drink was maintained at 4 ± 1°C for 24 h and then used for microbiological and chemical analyses before feeding the animals in group III, Kefir samples which were stored for more than 3 days were not used. Animal treatment was continued for 4 weeks then the experiment was concluded and animals were killed under anesthesia, blood samples were collected and livers, kidneys and spleen were rapidly removed then weighted to calculate relative liver weight to body weight.

Biochemical analysis

Each blood sample was placed in dry clean centrifuge tube, and then centrifuged for 10 min at 3000 revolutions per minute (rpm) to separate the serum. Serum was carefully separated into clean dry Wasser man tubes by using a Pasteur pipette and used for determination of serum liver function tests; aspartate aminotransferase (AST) (biolab), alanine aminotransferase (ALT) (biolab) and alkaline phosphatase (ALP) (biolab) using standard techniques by manufacture’s

Histopathological examination

Tissue samples were collected from liver, kidney and spleen of all animals (Group I-IV). These samples were fixed in neutral formalin solution 10% for 72 h after that fixed samples were processed and stained by Hematoxylin and Eosin according to Bancroft and Gambles.

Results

The antimicrobial activity of kefir against pathogenic microorganism

Antibacterial activity of kefir fermented for 24 hrs and 48 hrs fresh or kefir fermented and stored for 7 days at 4 -8°C was estimated by disc diffusion method. It was noted that Kefir has antibacterial activity against Staphylococcus aureus, E. coli and Salmonella enteritidis (Figure 4). For E. coli, S. enteritidis and B. subtilis The antimicrobial activity was superior to control antibiotics. The tested products exhibited no activity against P. aeruginosa and C. albicans. The results demonstrated that kefir possesses high antibacterial movement coordinated against Gram-negative and Gram-positive strains (Figures 4-6).

probiotics-health-antimicrobial

Figure 4: The antimicrobial activity of kefir against Gram-negative E. coli.

probiotics-health-antimicrobial-activity

Figure 5: The antimicrobial activity of kefir against Gram-negative Salmonella enteritidis.

probiotics-health-kefir-against

Figure 6: The antimicrobial activity of kefir against Gram-negative Staphylococcus aureus.

Kefir microbiota identification by partially sequencing the 16S rRNA

Identification of isolates to the species level was based on sequencing of 16S rRNA gene. The PCR of 16S rRNA gene using specific primers was done and revealed positive reactions and correct amplicon sizes DNA sequencing for the PCR product of 16S rRNA gene was done and the obtained sequences were analyzed using both Bioedit v.7.0.9.0 and CLC sequence analyzer programs. The homology search of the obtained sequences using BLAST tool at NCBI database to categorize the Kefir microbiota to the closest species as in Table 1. The obtained sequences were deposited in NCBI Gene Bank database and accession numbers shown in Table 2. The kefir microbiota were closely related to Micrococcus cohnii (isolate ID 14), Lactobacillus kefiranofaciens ZW3 (isolate ID 22) and Lactobacillus casei strain KF11 (isolate ID 23).

Target gene Primer Name Sequence 5' - 3' Size (bp)
16 SSU rRNA 16 SSU rRNA 11F
4R
16F
TAACACATGCAAGTCGAACG
ACGGGCGGTGTGTRC
AAACTYAAAKGAATTGACGG
1356 498

Table 1: Oligonucleotide primers used in PCR and sequencing reactions and their expected product size.

Strain ID  Product size Closest isolate Accession number Max score Total score Query cover Evalue Max ident
14 390 bp Micrococcus cohnii strain WS4601  NR_117194.1 217 217 91 % 4e-56 78 %
22 560 bp Lactobacillus kefiranofaciens ZW3, CP002764.1 2874 11492 100 % 0.0 99 %
23 518 bp Lactobacillus casei strain KF11 KR816166.1 957 957 100% 0.0 100%

Table 2: Strains identifiers and their accession numbers.

Protective effect of kefir against risk of carbon tetrachlorideinduced liver toxicity and other damages in mice

Effect of treatment on body weight and relative liver weight: Effect of treatment on body weight and relative liver weight to body weight were estimated as illustrated in Tables 3 and 4; the ratio of liver weight to 100 g body weight was significantly increased by sole administration of CCl4 (1.9900 ± 0.13565, p<0.05) compared to control animals showing (1.1070 ± 0.04842), Interestingly treatment with both kefir and CCl4 exhibited liver weight/100 g body weight ratio showing (1.3900 ± 0.08741) which is significantly lower than CCl4 group (p<0.05) and was close to normal value. By comparing the total body weight at the end of experiment to its corresponding initial value, only CCl4 group exhibited a significant decrease compared to its corresponding initial weight (Table 4). Note northerly, the body weights exhibited by combination group had higher values compared to both it initial body weight and body weights exhibited by CCl4-treated group however it is still less than the control values as illustrated in Table 4. Data were calculated as relative weight of liver to 100 g animal body weight at the end of the experiment. Data are presented as mean ± standard error of 10 animals/group.

Treatment Groups Liver weight/100 g bw
Control 1.1070 (n=10) ± 0.04842
Kefir 1.1190 (n=10 ) ± 0.04656
CCl4 1.9900 (n=5) ± 0.13565 a,b
Combination 1.3900 (n=5) ± 0.08741 a,b,c
Total 1.3103 (n=30) ± 0.06545

Table 3: Effects of kefir on liver weights of mice which treated with carbon tetrachloride (CCl4) at the end of study (4 weeks).

Treatment Groups Body weight((%of initials)
Control 27.2000 (n=10) ± 0.48419
Kefir 27.3100(n=10) ± 0.58356
CCl4 22.3000 (n=5) ± 0.96954 a,b
Combination 24.4000 (n=5) ± 0.87178 a,b,c
Total 25.9533 (n=30) ± 0.47766

Table 4: Effects of kefir on body weight of mice which treated with carbon tetrachloride (CCl4) at the end of study (4 weeks).

A, B or C indicates significant difference from control, kefir or corresponding initial body weight respectively at p ≤ 0.05 using Tukey’s test as post ANOVA test and as showing in Figures 7 and 8.

probiotics-health-presented

Figure 7: Effects of kefir on liver weights of mice treated with carbon tetrachloride (CCl4) after 4 weeks. Data are presented as mean ± standard error of 10 animals/group. aSignificantly different from control value at p<0.05. bSignificantly different from Kefir value at p<0.05. cSignificantly different from CCl4 value at p<0.05.

probiotics-health-tetrachloride

Figure 8: Effects of kefir on body weight of mice which treated with carbon tetrachloride (CCl4) after 4 weeks. Data are presented as mean ± standard error of 10 animals/group. aSignificantly different from control value at p<0.05. bSignificantly different from Kefir value at p<0.05. c Significantly different from CCl4 value at p<0.05.

Effect of treatment on liver function: The serum levels of liver functions (AST, ALT, and ALP) are presented in Tables 5-8. In the CCl4 treated group, the serum levels of AST, ALT, and ALP p<0.05, increased to 1372.6367 ± 2.06498, 1410.2500 ± 2.60688 and 251.4583 ± 16.79796 respectively compared to negative control group values of 38.1200 ± 0.60255, 45.0820 ± 0.80311 and 67.8300 ± 0.50400 respectively. The pretreatment of CCl4-treated mice with kefir significantly p<0.05, decreased the CCl4 induced elevation of these markers levels to 561.5050 ± 2.79362, 472.8833 ± 1.85210, 112.5600 ± 2.62721, respectively.

Treatment Groups AST
Control 38.1200 (n=10) ± 0.60255
Kefir 39.3470 (n=10) ± 0.35139
CCl4 1372.6367 (n=6) ± 2.06498 a,b
Combination 561.5050 (n=6) ± 2.79362 a,b,c
Total 386.8600 (n=32) ± 92.22711

Table 5: Effect of kefir and carbon tetrachloride on liver function test (AST) in mice after four weeks of treatment.

Treatment Groups AST
Control 45.0820 (n=10) ± 0.80311
Kefir 46.4830 (n=10) ± 0.43301
CCl4 1410.2500 (n=6) ± 2.60688 a,b
Combination 472.8833 (n=6) ± 1.85210 a,b,c
Total 381.7016 (n=32) ± 93.40436

Table 6: Effect of kefir and carbon tetrachloride on liver function test (ALT) in mice after four weeks of treatment.

Treatment Groups Alp
Control 67.8300 (n=10) ± 0.50400
Kefir 68.5500 (n=10) ± 0.56239
CCl4 251.4583 (n=6) ± 16.79796 a,b
Combination 112.5600 (n=6) ± 2.62721 a,b,c
Total 110.8722 (n=32) ± 12.84858

Table 7: Effect of kefir and carbon tetrachloride on liver function test (Alp) in mice after four weeks of treatment.

                                                   
Descriptives
  N Mean Std. Deviation Std. Error
Liver weight/100 g bw Control 10 1.1070 0.15312 0.04842
Kefir 10 1.1190 0.14723 0.04656
CCl4 5 1.9200 0.30332 0.13565
Combination 5 1.4900 0.19545 0.08741
Total 30 1.3103 0.35846 0.06545
Body weight (% of initial) Control 10 27.2000 1.53116 0.48419
Kefir 10 27.3100 1.84538 0.58356
CCl4 5 22.3000 2.16795 0.96954
Combination 5 24.4000 1.94936 0.87178
Total 30 25.9533 2.61623 0.47766
  N Mean Std. Deviation Std. Error
ALT Control 10 45.0820 2.53967 0.80311
Kefir 10 46.4830 1.36931 0.43301
CCl4 6 1410.2500 6.38553 2.60688
Combination 6 472.8833 4.53670 1.85210
Total 32 381.7016 528.37486 93.40436
AST Control 10 38.1200 1.90543 0.60255
Kefir 10 39.3470 1.11120 0.35139
CCl4 6 1372.6367 5.05815 2.06498
Combination 6 561.5050 6.84293 2.79362
Total 32 386.8600 521.71534 92.22711
Alph Control 10 67.8300 1.59377 0.50400
Kefir 10 68.5500 1.77842 0.56239
CCl4 6 251.4583 41.14642 16.79796
Combination 6 112.5600 6.43532 2.62721
Total 32 110.8722 72.68256 12.84858

Table 8: Descriptives.

Interestingly, kefir administration does not exhibit any significant change from control values of liver functions that is mean the Kefir protects liver against carbon tetrachloride as showing in Figures 9-11, respectively.

probiotics-health-tetrachloride-carbon

Figure 9: Effect of kefir and carbon tetrachloride on liver function (AST) in mice after four weeks of treatment. aSignificantly different from control value at p<0.05. bSignificantly different from Kefir value at p<0.05. cSignificantly different from CCl4 value at p<0.05.

probiotics-health-function

Figure 10: Effect of kefir and carbon tetrachloride on liver function (ALT) in mice after four weeks of treatment. aSignificantly different from control value at p<0.05. bSignificantly different from Kefir value at p<0.05. cSignificantly different from CCl4 value at p<0.05.

probiotics-health-liver-function

Figure 11: Effect of kefir and carbon tetrachloride on liver function (Alp) in mice after four weeks of treatment. aSignificantly different from control value at p<0.05. bSignificantly different from Kefir value at p<0.05. cSignificantly different from CCl4 value at p<0.05.

Data were presented as mean ± standard error of 10 animals/group a, b or c indicates significant difference from control, kefir or CCl4 respectively at p<0.05 using Tukey’s test as post ANOVA test

ALP: Alkaline phosphatase; AST: Aspartyl aminotransferase; ALT: Alanine aminotransferase.

Histopathological examination

Liver: Control group: In the control group, the liver was histologically normal without noticeable alterations (Figure 12a) with well demarcated hexagonal lobules having a central vein with normal portal traits containing artery, vein and bile ducts. The hepatocytes within the hepatic lobules were arranged in cords radiating around the central veins and separated by hepatic sinusoids.

probiotics-health-Photomicrographs

Figure 12a: (1) Photomicrographs of hematoxylin and eosin stained histological section of normal liver.

probiotics-health-vacuolar-degeneration

Figure 12a: (2) Photomicrographs of liver of CCl4 –treated animals showing variable degrees of vacuolar degeneration.

Carbon tetrachloride (CCl4) group: In this group, the liver of the animal showed variable degrees of degeneration, necrosis and inflammation. Moderate to severe vacuolation of hepatocytes (hydropic degeneration to fatty changes) were seen especially at the periphery of the lobules (Figure 12b), in contrast to those around central veins which appeared normal. Mild to moderate sinusoidal dilatation with active proliferation of van Kupffer cells were noticed in most animals (Figure 12c). Necrotic changes accompanied with fatty changes were also found in some areas; in which the hepatocytes had pyknotic nuclei with strong eosinophilic cytoplasm or severe destruction (Figure 12d). Mild to moderate portal tracts and hepatic parenchyma infiltration with leucocytes was evident (Figure 12e) with congested blood vessels.

probiotics-health-proliferated

Figure 12b: Photomicrographs of liver of CCl4 –treated animals showing widened sinusoids, active proliferated Von kupffer cells.

probiotics-health-necrotic-changes

Figure 12c: Photomicrographs of liver of CCl4 –treated animals showing necrotic changes in the form of severe destruction of hepatocytes or karyolysis.

probiotics-health-infiltration

Figure 12d: Photomicrographs of liver of CCl4 –treated animals showing leucocytic infiltration in the portal area and hepatic parenchyma.

probiotics-health-hepatocytes

Figure 12e: Photomicrographs of liver of CCl4 –kefir treated animal showing much less damages in the hepatic parenchyma, more or less normal hepatocytes.

In CCl4-kafir treated group: Histopathological examinations proved mild to moderate improvements in the form of absence of hepatic necrosis, however, some cells showed degenerative changes (Figure 12f). Sings of regeneration was noticed in some areas as some cells showed mitotic activities and binucleation in others. The hepatic sinusoids appeared also of normal appearance with mild congestion was seen in some animals. Compared to the CCl4 treated animals, much less damage could be seen especially in the peri-central hepatic cells with mild inflammatory changes.

probiotics-health-degeneration

Figure 12f: Photomicrographs of liver of CCl4–kefir treated animal showing very mild vacuolar degeneration with no evidence of necrosis, mild congestion and no inflammatory changes.

Kidneys: Control group: The renal tissue of this group appeared of normal structure especially the renal cortex (Figure 13a). Renal tubules and glomeruli were histologically normal. The tubules were linned by columnar epithelium and Bowman’s capsules were normal and had normal glomeruli. Minimal changes were noticed in some areas in renal medulla. The renal pelvis also appeared normal.

probiotics-health-normal-structure

Figure 13a: Photomicrograph of kidney of control mouse showing normal structure.

CCl4 -treated group: Histopathological examination revealed mild pathological alterations. The most common changes were hydropic degeneration of renal epithelium of some tubules (Figure 13b) with mild congestion of some blood vessels (Figure 13c). Early necrotic changes were demonstrated in outer cortex. Glomerulonephritis was seen some areas (Figure 13d). Marked vacuolation was evident in renal medulla. No signs of an inflammatory reaction could be seen except in one case, which appeared as focal mononuclear cell infiltration in the renal cortex (Figure 13e).

probiotics-health-renal-epithelium

Figure 13b: Photomicrograph of kidney showing CCl4-treated mouse had vacuolar degenerative changes in the renal epithelium.

probiotics-health-treated-mouse

Figure 13c: Photomicrograph of kidney showing CCl4-treated mouse had early necrotic changes.

probiotics-health-congestion

Figure 13d: Photomicrograph of kidney showing CCl4-treated mouse had congestion of renal blood vessel.

probiotics-health-leucocytic

Figure 13e: Photomicrograph of kidney showing CCl4-treated mouse had focal leucocytic infiltrations.

CCl4-Kefir treated group: The histopathological changes in these animals were much less in comparing to the CCl4-treated group. Renal tubules had minimal pathological changes (hydropic degeneration) in most areas with mild congestion and without inflammatory changes (Figure 13f and 13g). The glomeruli showed no histopathologic alterations.

probiotics-health-moderate-improvement

Figure 13f: Photomicrograph of kidney of a CCl4-kefir treated mouse had moderate improvement of renal lesions; mild vacuolar degenerative changes in the renal epithelium with absence of necrotic changes.

probiotics-health-blood-vessels

Figure 13g: Photomicrograph of kidney of a CCl4-kefir treated mouse had mild congestion of renal blood vessels with no focal inflammatory reaction.

Spleen: 5.5.3.1. Control: In the control group, spleen appeared more or less normal at the level of white and red pulps (Figure 14a).

probiotics-health-control-animal

Figure 14a: Photomicrograph of spleen of control animal showing normal histological structures.

CCl4-treated group: With regards to the spleen histopathological examination, splenic changes involved hyperplasia of lymphoid follicles of the white pulp (Figure 14b). In some follicles mild lymphocyte destruction (rarefication) was found. Moreover, the red pulp of splenic tissues showed significant congestion of blood vessels and sinusoids with mild edematous changes (Figure 14c).

probiotics-health-lymphoid-follicle

Figure 14b: Photomicrograph of spleen of CCl4 treated animal had hyperplasia of lymphoid follicle with rarefication of lymphoid elements

probiotics-health-eosinophilic-edematous

Figure 14c: Photomicrograph of spleen of CCl4 treated animal showing eosinophilic edematous changes.

CCl-kefir treated group: The remedy effect of Kefir was observed in splenic tissues that revealed no prominent lymphoid hyperplasia in the white pulp or congestion in the red pulp; so it appeared to be more or less normal (Figure 14d).

probiotics-health-histological-structures

Figure 14d: Photomicrograph of spleen of CCl4-kefir treated mouse had more or less normal histological structures.

Statistical analysis

All data were expressed as means ± standard error of the mean (S.E.M). Statistical analysis was done using statistical packages for social sciences (SPSS) computer software (version 22), IBM software, USA. One-way analysis of variance (ANOVA) test was used to elucidate significance among group means, followed by Tukey’s post-hoc test to compare mean values pair-wise. Differences were considered significant at p<0.05.

Discussion

Recently, there is a strong focus on beneficial foods with probiotic microorganisms and functional organic substances especially the commercial use of kefir. It may act as a matrix in the effective delivery of probiotic microorganisms in different types of products as it has a biological activity due to the presence of kefir’s exopolysaccharides, known as kefiran. Kefir is mainly considered a probiotic resource because of its composition [28]. According to definition “Probiotics are microbial cell preparations or components of microbial cells with a beneficial effect on the health of the host”. Some studies suggest that probiotic bacteria in kefir consumers’ gut are increased and play an important role in health improvement [29].

The probiotic species, particularly lactobacilli are equipped for creating an extensive variety of antimicrobial mixes, counting natural acids (lactic and acidic acids), carbon dioxide, hydrogen peroxide, ethanol, diacetyl and peptides (bacteriocins) that can be helpful not just in diminishing sustenance pathogens and bacterial harm amid capacity and sustenance consumption, additionally in the treatment and counteractive action of gastrointestinal and vaginal infection [25]. kefiran has more advantages, comparing to other polysaccharides, such as bactericidal, fungicidal, and antitumor properties [30,31] antiinflammatory and promote healing [32,33] immunomodulation or epithelium protection [34]and antioxidant activity [35].

Our results demonstrated that after 24 h as well as 48 h, fermented kefir possesses high antibacterial activity against Gram-negative and Gram-positive including Staphylococcus aureus, E. coli and Salmonella Enteritidis. The antimicrobial activity was superior to control antibiotics, although exhibited no activity against P. aeruginosa and C. albican. These results agree with previous study which showed that kefir as a probiotic can restrain the action of coliform microscopic organisms, and some entero pathogenic microscopic organisms like Shigella sp., Salmonella sp., and of Gram-positive microorganisms, for example, S. aureus, Bacillus cereus, Clostridium sp. and Listeria monocytogenes tyobutyrivum [36].

In this study Microbiota isolates of the kefir were closely related to Micrococcus cohnii (isolate ID 14), Lactobacillus kefiranofaciens ZW3 (isolate ID 22) and Lactobacillus casei strain KF11 (isolate ID 23). Micrococci, like many other representatives of the Actinobacteria, can be metabolically versatile, with the ability to utilize a wide range of unusual substrates, such as pyridine, herbicides, chlorinated biphenyls, and oil. They are likely involved in detoxification or biodegradation of many other environmental pollutants Other Micrococcus isolates produce various useful products, such as long-chain (C21-C34) aliphatic hydrocarbons for lubricating oils [31].

An exopolysaccharide (EPS) producing strain, ZW3, was isolated from Tibet kefir grain and was identified as Lactobacillus kefiranofaciens. FT-IR spectroscopy revealed the presence of carboxyl, hydroxyl, and amide groups, which correspond to a typical hetero polymeric polysaccharide. The GC analysis of ZW3 EPS revealed that it was glucogalactan in nature [31]. Lactobacillus casei is a species of the genus Lactobacillus found in the human intestine and mouth. This particular species of Lactobacillus is documented to have a wide pH and temperature range, and complements the growth of L. acidophilus, a producer of the enzyme amylase (a carbohydrate-digesting enzyme) [25].

Kefir was found to have a protective effect against CCI4-induced damage in liver, spleen and kidney. Histopathologically, compared to CCl4 treated mice, mild to moderate improvements in the form of absence of neither hepatic degeneration nor necrosis with sings of regeneration (increased mitotic activities and bi-nucleation). The hepatic sinusoids appeared also of normal appearance with mild. Renal tissues showed minimal degeneration. Spleen also showed marked improvement comparing to CC14 treated animals.

Kefir has a histopathological preventive attribute in animal model as it lower the necrobiotic changes in acute renal injury [37]. The adverse findings of CCl4 (hepatocellular damage and apoptosis) were reduced with kefir administration; this indicating that kefir has a protective role at liver damage [38]. Also it has been found that no toxic effect of L. kefiranofaciens M1 was seen at the gross and microscopic histopathology of the organs (heart, liver, kidney, adrenal glands, spleen, ovary, and testis).

Kefir was chosen in our study as a potential protective agent because of its antioxidant activity. According results of this study, CCl4 induced liver toxicity in mice and it is harmful to other organs such as kidney and spleen which was in the form of increased liver weight to body weight, elevated liver enzymes and alkaline phosphatase, an indication of structural and functional defects in liver cells. Marked improvement was evident with treatment with kefir as indicated by estimation of body weight and relative liver weight to body weight; the ratio of liver weight to 100 g body weight was significantly increased by sole administration of CCl4 (1.9900 ± 0.13565, p<0.05) compared to control animals (1.1070 ± 0.04842). Interestingly treatment with both kefir and CCl4 exhibited liver weight/100 g body weight ratio (1.3900 ± 0.08741) which is significantly lower than CCl4 group (p<0.05) and was close to normal value.

At the end of experiment, comparing the animal total body weight to its corresponding initial value, only CCI4 group exhibited a significant decrease compared to its corresponding initial weight. Note northerly, the body weights exhibited by combination group had higher values compared to both its initial body weight and body weights exhibited by CCI4-treated group however it is still less than the control value. Data were calculated as relative weight of liver to 100 g animal body weight at the end of the experiment. Data are presented as mean ± standard error of 10 animals/group.

Kefir effectively has protection against CCl4-induced hepatotoxicity in mices. These protections are approved via the serum levels of liver functions (AST, ALT, and ALP). In the CCl4 treated group, the serum levels of AST, ALT, and ALP p<0.05, were increased to 1372.6367 ± 2.06498, 1410.2500 ± 2.60688 and 251.4583 ± 16.79796 respectively compared to negative control group values of 38.1200 ± 0.60255, 45.0820 ± 0.80311 and 67.8300 ± 0.50400 respectively. The pretreatment of CCl4-treated mice with kefir significantly p<0.05, decreased the CCl4 induced elevation of these markers levels to 561.5050 ± 2.79362, 472.8833 ± 1.85210, 112.5600 ± 2.62721, respectively. Interestingly, kefir administration does not exhibit any significant change from control values of liver functions that is mean the Kefir protects liver against carbon tetrachloride. In conclusion, our findings revealed that kefirhas antimicrobial activity against pathogenic microorganisms and protective properties against CCl4-induced hepatotoxicity. These protective effects included anti-inflammatory effect and inhibition of CCl4 activity with improving of liver function. So, kefir may have the potential for clinical application to the prevention and/or treatment of liver toxicity.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Recommended Conferences

Article Usage

  • Total views: 47
  • [From(publication date):
    August-2017 - Jul 26, 2017]
  • Breakdown by view type
  • HTML page views : 29
  • PDF downloads :18
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
adwords